Description :
From Genome Similarity Track
Location :
Scaffold_112:232627- 233969
Transcript NameFunction/comments
Physo_142362retrotransposon element

Sequence
1342 bases(100 bases per row)
GCTAGATAGCAGTGTTTGCCTCTAAGTCCTCGCGCGTGGCCTTTCAGCAGTGACAGGCGCGCAATCGTGTCGACAGCCTCGAAAGGCGCTCACACACTAG
CGAGCGAAAGCGATGGGTGCGGCTCTTAGTGAAACACCACTACTGCATTATCTTCCAATAGCAAGCCTGAAACACGATCTTTCGCTTGAACCGCCATGAA
CTTTGCTGCCATCAGCATCTCCCAAACGAAGCTAAAAAACCTGAACTATCCAAGCGGCTTCCCGAGTTCGCAAGGTTTTTCAAAGGAAGATGCAAAACGG
CCATTCCAGGTTCGTACGAAAGGATTTTCGTATTTGCGAACTGGAATCGAGACGTTTCGTGCTTCGGGTTGCAGGAGTTCGTTCCAGCTGAGCCCAGAGT
CGACTGCCGTTGGTCAGTTGCTGGGACGTGACAGACGAAACCTCCTGCCTCGACGAAGTCGCTTGCAGCGTCGCTGTATCCCGGAGTTTCTTATCTTCTA
TAGTCGTCTTGAGATCTTGTCGCGAAACCCCTGACGCTGCTGTGCCTTGACCGCACGTCGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGA
TCACCATGCGCAGTGTCACATACTTGACCACGGGCGAGAACGTCTCGGTGTAGTCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTT
GTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTATCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACA
CCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCTTTGCGCCAGTGCACTTGATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATA
GATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTC
GGGGTCGGCTCGGCGCGAGGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTTGTCGTCG
CCACTCGGTCGGTACTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGCTTGGCATGATGCAGCATGCTGCGGCCAATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTNT
GCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGT