Description :
From Genome Similarity Track
Location :
Scaffold_170:23262- 25827
Sequence
2565 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAGCTTAATGCTGCCACTATCCCGGCTCAGAAACCAATACCCAGAAAGGATGTTCTTCAGAACAGTATGTTGGGATGTACATTGTACAGTGCGCTCGACT
TAGTCCATGGTTATTATCAGCTGCTCATGCTAGCAAGCGATATTCCGCTAACAGCGGTTTTAGTACCCCAAGCGGTATGAACTTGGAGTGGCTCGTTATG
CCACAAGGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCACCGAGGCTATGCACAAACGTACTTTGATGACATCT
TTGCCCATAGTCGTGCAACGAACAGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGC
AAATACATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTCCGGAGTGCTTCACTGGGAAGCGAGGCCTTCGAGCGGACCCCGCCAAGATAAGGGCC
ATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGATCTACGTAAGTGGATTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATATGG
CTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGATTGGTGTTGGGGTGACCCGAACATGAGGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCG
CCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTCTTACAAACAGATGTCGATG
GACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTAATTGTTATGAAGTACGCTCT
AGTCAAATTCAGAGTACGTCTGCTTGGCTCAAAGCCATTTTTGATCTGTACAGATCATGCATCATTGCGCACTGCGACGCAGTCGCCGCATCTCTCTCAT
AGAATGACTCGTTGGCTCTCATTCTTTGCCGAATATAACCTCGAAGTGAAGTATAAGCCAGAAAAGCAAAATGCTTCGGCTGATGCGCTATCGCGTCGAC
CTGACTATGAGCTTTCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACG
TGCTCTTGGGAGCTAGGAGTTTAAAGACTCGGACATAGAATTGTCGGTACGTTTACGTGCGAGGCTACATCTATACTCTATCGATAATGGCCTGTTGTGC
TATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGTAGTATCAAATACTCTATGAGGTATATGATACCGCTTTAAGTG
GTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAAC
ATGTCAACGGGTGAAACCCTCAGCACATGCAGCGGCGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTT
GGCCTACCGAAAGATTCGGAAGGTAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATAGCTCACCTAGCGGCAGTGCCGGACTCTATTGATG
CGAAGGCACAGCGAAGCTGTTTGTCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCCCCGATCAAGATCCCCGCTTCACTGGGAAGTTT
TGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTA
ATAACATTTTACGCAGTGTTTGCGCTGATACGCCTATGCGCTGGAGCTGCATGCTCCCTATTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCGAC
AGGCTATACTCCGTTCTACGTAGACGGTCTCACCCACCCTCTCGTTCCGTAAACGCTACCACTATGTGGTACAGGGCTTGGTGGGGGAGAGGTTGCCGAT
CGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAGCGCGATTAAATGTCTTAAGACATGAGCGTTACGCAATGGCTG
AAAGCCAAGATCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTTTTGAACGTTATCAGGTCGGAGGCCAAGTATTACTCAATGCTAAAAACCT
ACCTACAAATGTAGTGTCCGATGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGGACCGTTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTC
AACCTTCCACGCAAATTGCGCACACATCCCGTGTTTTACGTGGGTTTGCTTAAGCCGTATCGGGA