Description :
From Genome Similarity Track
Location :
Scaffold_1735:2326- 3876
Sequence
1550 bases(100 bases per row)
TGGGGAACCGGTGAGTGCCCTCCCATATAGCAACCCGGTGCTTGGAGGCGAAATCCCGGAACGCCCGAACGAATACCCCGAGTCGCCCACGCACATCACC
CCTGAAGCTAACCGGATCCACCGGTGTGGTGACCAGCGTATCCCACGGGGCAGCACTTGTCAGTTCCTCCACGAGGGGTCTGGTGATGAGCGAATCCACG
TACCCGGCCCTCGGGATGGCGTCCGCTGTCCGAGGGAATATCCACTCAGCCCGAAAAGTCAACTCCGGAAACAGAACCGTGATCTTCATGGAGATGATCG
CAACTCGGTTCAATTTCTTGGCTGACCAAGGCTCGATGTCTCTGGCAGCGAAGGCCACAGGAGCACGTCTACCAGGAATGAAAGCAGCATCCGGACCGAA
CGGAGCCACGGGGAGCATCCCTGGCAGTGACGAGTTAAGGGGGGCGGGGATCAAGTAACAAGTGTGAACACGACGGAAAATGAAAAGGAGAGGAGTCGAA
TCCATGGTGGAGGTGTTGGAGAGAGAGTGGAGTGTGCTGATGCTGATGAAGGCACCAGCGAGGGTTCGTTCGGCGTAATTTCGAGTGCAGCGCGAGACGA
GCCCAAGGGTCACTCCAAGATGATGAAGTTGAACCATGGCGAGAGACAGGGGTGGTGGTCGGCCAAAAAATTCGACCGACGGATCAGAATGAGAGCTCTG
GTGCAAGGCGCTGTGAGCGACCAGCGAACGAGGATCCTCCTCGACACAGGAGCGAACGTTAGTATGATCACTGACGCCTTTGCCAAGAAGTTGCGGCTCC
GAGATGTACCCGATCACGGACGCCGCATTGGCATTCAAGAAATCAACGAAGGCAAGGTGTCTACGACGCGACGAGCGTGCGTCAAGATTACACTCGAATG
GGAGATGGTGTACGAATTCGAGATGTGGGTCATGGCGCATAGTGCAGGCGTCAACGTGGTACTCGGGACCGACTTTATGATCCCAGCCGGTTGGATCTGT
TTCACGGCGCGGCGCAATTGCCGCACGAAGTTCAAAACCCACTGATCAAGATAAAGAACATGATCGACAGCGAAGAATACGGCTTCCATGTTAACGCCGG
GCCACCTGAGCGTTTGGACATTCAAGCGCACGAGTGGCGAGAATATCGACTAGCGAAGCGTCAAGTTGGACTGGAAGAACATGTACTGTCGGTTCGTCGA
ACGAACAAGCTAATCCCGTCAGTGGCGAGGTTTTGGCGTGGACGGCCTCAGAGGATTCGATTGACCAAAGTATCCGACCAAACTGTGTACCTACCAGCAC
ACGACCCGATCGCGATGTGGATCCCAGATGGGGATTTGCCGCAAGGTTACGGCTATGTGCGTCTAGATTCATCGAGTTGTTTGTGGCTCGATTCCGATCG
ATCATTGCGGAAATGTCGTTAGAAACGTGGCAGAAACAAGTGAACGCTGTTGTGAAGGCCTTGTTGGAGAAACCCAAGCACGAGATGGAGGAATCCATGC
GTGCGTGGCGTGAGATCGCCAACGAGACGTTCGTGTTCGACCGTCGACAG