Description :
From Genome Similarity Track
Location :
Scaffold_11:232419- 235593
Sequence
3174 bases(100 bases per row)
GTACATCATCGCTGCCTTTAGGTATCTAGGGGTACTCTAAATGTTCTTATATGCGAAGGAAGAGCGGACAGTGAGCGGACGATGACACATAAACCAGATA
TCCCGTCCACTCTTCCTGTGCATAGAACGTCGCGCGATGTAGCCATTATGTCGATCTACTTGATCTCAGTAGATCGACGAATTAACAATTACCGACTTAG
ATGGACGCCGCGAGATGAACCTCGCGATGTAGCCACGAGAATGTCCATCTCGGGAGAAATATCTTGTATTCATACCACAGGATGTATGATATGAGCacga
agaaaaaaatgccaCATTCAGTTGTGTCACAACGGATGTGCCACGCCATTCTTTGCATCAGAGATAGACCACTGCTGCTCTTATCACTTGTGAGACATCG
CTCGAAAAGCGGATGGCACAATGGTGCAAAACTGAATAGGATTCACAAACCTTTCTAAAGTTTCTCTTTTCTACTGGGTACCCTTCCTACTctattatta
ttattattataAACTTAAACAAAGTAGTGTCATTGTGTCATTAGTataagagagagagagagagatcCCACTACTGATCGGGTCTCTCCTGATCTGAGAG
CAATGGCACAATGTGTCATCGGATGTGACACCCGGATGTCTACATTGACTGACAATGGGTTAGAGacattgatgatgttgacTAAGGTGATACTTAGTTG
TGACACTGAGTTGTGACATCGGAATGAAAAAAATGCATGATGATCCTGGGATTATATTATTGATTGATTTAATATGAACTAAAAAGGAGTGTCTCTGTTC
GTCTTCAATCTTCGTTGGTGTTGtagtcttcttcgtcaatcTGAGTCGCTGGCGGGACAATGGTAGTCTCATCGGTCGAGCTTTGATCAGGCACAATTGC
GTTGCTTGGCGGCGGTGACTGAGTAGCTAGTTCAACGGTCACCACTTCGTCGAACCGATTGGTCATACGATCAATGTTTTTTTGATAAACCCTCACCGAC
ATCTCGACCTCAACATCATCAGTCCATAGCATACGGCGGGGAATGTTGATCAACCGTATTTCGACTGAGGCGACGTAGGCCTCGTGTAGTCTCGGTGACG
GCGGCACAAAACGTACCCAAAGTCGGATCGCACCTTCACTATAGTTGCGGCATTGGTAACTACatgtaacgggactcagtccaaacctgcccacgcaaag
cgaagagctggttgagctgatcccgaacacccgaacacccgaacacccgaacagaggaagctgttcacAGCACGGTCTGGCAGGAGTGCGAGTCAATGCT
GGAGCCCGAAGCGAGCGGAAATCGCACAGAGACGAGCCGGATGCTTcggctgggtcttcggtcttgaagagcaaacggactcacaaacCTCTGAGCCGAT
ACTCTTGTCTTGGGAGGGTGACTTGGGCAGTTGTgggtaaaattgcaactTAATTAAAATGAGCTTATGGTTCCTGAATCCTATGAATAAAACCACTAGG
GGNATTTAACGTAATCACTGATTGCGCcaaaggtgaatgcgagcaaatatgtacccatgtttgcgccaccttcaccttcatgacggaagtgtgtgtacca
caccaatctgtgATCCCATTGTCCATGTAATAGGCCAGAGGGCCCCATtacaaatagttcatgtgggtatcggttatttaatAGATATCATTACAGATAA
CTGctacccacaatgaacccagaaggtggtgtgtcccacacaaccacctcatgtaatgggatgaccagacccattacacCTTGCCAGCATTATATAATCA
CACTGCAAGTCGTTCAATGGCATGAGAgaaacgaagaagacaagattgatgaagttgtATCCGTCCTGTTGTCATTGAAGTGGTGCCAGCAGTAACGAAG
AGTTGAATCCACACCATCTGCCTGTAGCAGAACCATTTTACCACCTCCTTGTAAGATATCGTGGGAATCAACGATTGTTAAGACGTATTATTAAGACCCC
AGCATGGTGGAACCTCCAATTAAGGGCATGATacttcttctcttcctcactgATCCTTCTTCGTAgccgtcttcgtcattcACTTCAGTGACACTCGTTA
CGTCTAACTTGATGACACCGCCATGTCATAAAAAGCTTGGCTGCGAGATACTCCTCTTGCGTCTGGAAATCACTTGGATCTTGGCATGACGATTACCAAG
GGTGCCCATCCACCTTATCGGTtggaaccaccaccaacacacaGAGCCAACTCGCTCAGAAACTGCATGCACCATACTGTAGCTGTGAGGTCATTACACT
TGGACGTCGGGTTGGCATCTATATTCCCATTTCTCGATGAATGGACATTTTCAAGATTTTGCTGAAGCCAAAGATTCGCCAAGCGAAAAATGGTTCAACA
AGATGATTAATCTCTAGATACCTTTAACAATATATAATATAACTGTGTATATGTGTATATGTGTATATTGTAGTATAGTCTATAGAGTTTGAAGAGTCAT
GCAAGTTTCGTTTGATACATGTAAAAAAGCTGGGGGCAGATCGCTATGTATGATATACACAACACCGATTTTTATAGCATTGCAATAGGAGCTGGACACG
TAGTGTAGAATATGTTAGCTTGAAAGGAGTGTGCCAAATTTGTGCATAAAATGAAGCACCATGGCGCGGTATCGCGTGTATCTATAGTTTCAGCATCTCT
CGTTGGGCGTGGCTGTGCTTGGCCTCGCGGGATGCACTTTGTAGTATATTCCATTATGTTTCAGATTGCATGGCTACATGCGCGCGTCTCATTGTGCCAT
AACACGCGTCAGTGTCTCGCGTTGCTGTCTCTATTTATGCCTCTTTCATTACTGATCGGATAGAGCTCCGGGAGCCATTTCAAACATTGCATATACTGAT
GACAATTTGATTGACACATTCGATTAACTTGAGTGTATTTTTGGCATTGTGAATAATCACACTGAAAGTCATCTGAATTGTATCAGAGGGAAACAAGTTT
TTTCTTCAATATTCGAACACGAGTTTAGCCATTTGGATCAGCACCCCGCGTTTCATGGGTGCGCTAAGGCTGTATTTTGTATTATTTAATTAATATTCGA
CAAGTACCGTATCCCTATCCGTATAGACATAAAGTAAAATGGATACACTTACAGTAAATTTTGGAAAGTACCAT