Description :
From Genome Similarity Track
Location :
Scaffold_1669:2324- 3969
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1669-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
1645 bases(100 bases per row)
GCGCAAGCAATGGACAAGTGGAGAGCTACTGATGTGTGCAGTGCTAGAGCTTCTGATTGTGCACATTGCGTACCACGTCGACCGTCAGAAGAGCGCTCCT
TTCCTGTCAACTGCCGCCTGGGCGATCCTGTTTGGCGTTGGAGTGAGTATTTTGCATGGTTTGGTGGTGAGGGATATTTGTAATTGTCAAGCCTAACGAA
CTCGCTTTCTGATATGTGCCACCGTCATTGCAGTTCGGTCTGGTGCTGTCCTCGATATCAAATGACGTACGTGACGACGAGGGTGCGTTCTGCTGTGTCT
GTCGAGTGGTATATAACGTGCTGATATTTTCCTCATGCTCTGTATGTAAAGCACGCAACCGACATGGGCATCAATCCGCACATCCTCTTCTCTGTGTTGC
TGCCTCCGATCATCCTGGAATCCGGCTTCAACAGCCAACACCGTCGCTTTTTTGCCAACTTCTGGGATATCTTCATGCTGGGTGTCGTCGGCACAGTCGC
GACAGCGTGCTTGATTGGTGCATTAGTCTACTGGCTGGGCCAGACGGCGCTGCTCTCGACGTCACTTTCACCAGCTGGGGCGATGCTGTACGGCTCGCTC
ATTTCGGCGATCAACCCGATCGCTACGCAGCTTATTCTCCGAAAGAGCCACGTGCCGCTGCTGATCCCCGAGCTTCTTTTCGGCGAGCACTCTATCAACA
ACGGGATATGTAAGTCATGCGATTGTTATCAATTGTTTACCTGCTGTCGATAGCCTTGCAATTTTTGAGACGCTAATAATTGCTGTGTGGAGTAGCGATC
GTGCTTTACAATCTCTGTGAGAAGCACGTGCAAAGCGGTGACACCGAGACGAGCGTTTGGAGTGGACTGGTCTTGTTTGCAGAGTTGATTGGCATCGGTG
CCGGCTCGCTTGTACTGGCGGTGATCTTCGGGCACGGGTCTGTATACCTGCTGCGAGTAAGTGTGTGATATTTGTCCCTGACTTGCATACTCTGGGACTG
AGAATAAGTGCTGTGATGATGCATGCTTTCTGTAGAGGTCGAGAATTATGCTTCAGCAGCACCAGGTTTACGAGAGCTACACATTGTTACTCGTTGCGTA
CACGAGCTACATGGCGGGCGAGTTCTTTAACCTGAGTGGGCATCTGGCAGTCTTCTTCAGCGGCGCGTTTATCCGACACTACCACCTGAACAGCATCTCG
CGTGCAAGTGCAACGACGTTCAAGCACCTGCTGTCCACGTTCTCGTTCCTGGCCGAGAATTTCATCTTCCTCTACCTGGGCGTGAGCCTCTTTGCCTGTG
AGTACTGCTTATATACTCTTGGCTGTCCATACATGAATGGTTTGAACAAACTGACACGCCCGTGCAATTTCAGATTCGGACACATTTGAGTGGGACTGGA
GCTTCACGCTCGTGACCTTTGCGGTATGTTTTGCTGCGCGAGCGCTCGTCGTGTTTCCAATCTGCAGCGTCGCGAACATTTGGCGAGCAATCCCGTTCAA
GTACATGGTCGTGATCTGGTTCTCGGGTCTTCGTGGCGCAACCGCTTTTACGCTGTCGCTGAATATCAAAGACATCGACCGCACGAACCACGCCGCGATC
ATCCGTAGCTCGACGATCTTCACAGTTTTGACGACGACTATCGTG