Description :
From Genome Similarity Track
Location :
Scaffold_39:232393- 233709
Transcript NameFunction/comments
Phyca_LT1534119534predicted protein

Sequence
1316 bases(100 bases per row)
atattgcaaatagtactgggctctacaacagtgaagcggatcagtgtgctacggtagagaagaccaacaacgatgtttttggcgtgcaaggttaaatggg
ttagccgatggcattggcgcttcataggaattgtttcgagcagtggtgtgacagtttagtaatggcctggaggcacggtaccaacaactgggattattaa
ctaagtcagtatgacatattaaatttggttatttattttctcaagaaaatactaacaatgaataattggtttgttgtgcacatggctacgtcagctaatc
ctgagtataatttttcttgctcagggtcaaaaatatactaggtacattgtcggatgttttttcaagcgccaaagcagtcttagaaaaggattcggacaat
acttatcgataaaggctttgtggaatggggcgtgcttgaaaaggcatcccctcacgccaaagaactttgtgtcggttctaggagctcataatgcttttgc
agaagtctaatattcaaccttaagatagtgcggcgtggtagcacggaagatgctttcgctaacctcatctataggtgtggagcagcttaataggatgttg
tgttgccaattgtgttgatgtctgtgttttttatcctgtggactgactacgttgctgcttgtattgcgaattatgtcgtactaattcgcaatattatcgt
ttaatggtagacttccaaaaataacacaattgcaagactgtgtcggtcatatcatgacatatgtgtcggtcttgatccagtacatgtgcgtggtatatga
ctggtttgtgtattaccagtcctccaaaaataacacatgcaaagcggtataaccttcgatgaaagttagttgctgattgtcatttcagcgttcttcagca
gtggtgcacagcgaaacggagtgcaaggtactttaaagacatggttcacagcactattatcctctacgccaacctgaatcgccgtcgccagcacgaatta
cgtcataagcgtcaactcaagtggaaaattgctgctttgcttcgcgttcgtatgactctcagagttcgcaactacctgacctcaagtgcgcttatatctc
cgtcgaacagcccatgggctcaaatttacagaagcagagacgatggagcgtttatcaatacggtggcaataccagtggcggcatttgaaagattactgct
atcgtttacagcacactacgttgttaagagcggtcctggcaaacgaggacgtcctcctcgcttctgtagcatcaataacgttctcgcgtgtcttctacat
ttttacgcgcacgcag