Description :
From Genome Similarity Track
Location :
Scaffold_22:23238- 24974
Transcript NameFunction/comments
Phyag_g630hypothetical protein PHYSODRAFT_507179

Sequence
1736 bases(100 bases per row)
ATGGAGGCGCACGTCGACATCAAGGAGCAGCTTCTACCCAGCCCCCCCAACACCGTCAGCGAGTCGTTGGTCAGTCTCTCACAGCCTCCAAGCCTGGCAA
CTCCaacgagagctgcagcgtgccGGTCCACCCCGTTGGATTCGGCCGCACAGGCCAACGGCGTGGctgatctccatctcgtccttcaTGTGGGGCTTCA
CCACCGCCGTGCTCAATGTCTGCATCGTACCGGACGCCGTAGGATCATTACTTATGGATATCAACCTGTCAACCGAACAGCAGGAGCGAGCCACCGCACT
CGTGGTGGTTGGATGCATCCTCTCAGCTCTCTCCACCGGCGACATCGGTGCACACATTGGCCAGAGGAAGATCATCCTGTGGAACAACGTGCTGTATGTT
ATCGGCAGCGCTCTCTGCGCGCTCGCCACGTCCAATGGCGTGCTCTACGTCGGTCGCCTCATCGTCGGGTTGGCTTCGGGTGTCGTCGCCAATACGGTGC
CGATCCTGTTGACGGAGATCTCACCCGCTGCCTCCAGTGGCGAGATCACATCCCTCCACCAACTCAATGTGACGATAGGCATGCTCACCTCAGCCTTGCT
GGGCTATTGCCTCATCTCGAATGTGCCTCCGGGGTGGAGATACCTCAACGGATTCATGATCCTTCCCcctttgctgcagtgtttAAGCGCGTCGTTCGTT
CCCGAGAGTCCGTGGTGGCTCATGAAGAACCGGGGCCGGGACAAATGCCGCGAGACGCTCGTGTATCTACGTTCGAGCAACTAAAACGATGTCATTGAAA
CAGAGTTACATGAAATTACGCGCATCATAGAGTATCGCCAACACGAACCGCACGTGACCCGGTTGCGCCTACTGGAGCACAAAGACATTATGGTAATAGG
AACACTTCTCGTGTTTGTCCAAGCTATGGCGGGCGTCAACACGGTGATGTTGTACTCGGCGAAGATTTTCCACTTTGCAGGGGTGACCAACCCGTTTTTC
GCCACGACCGTCGTAGGCTTTACTATCGTGGGCGTCACTATGATATCGGTGCGCTGTGTTGATTCATACGGTCGGCGACCGCTGCTTCTCGTGGGCACGG
CTGTTATGATCGTCGCTCTAGGTGTGCTGAGCTGGTCACTGCTCTACCTCAACAGCAATCTTGCTGCGCAGGGAATGATAGCTGTGATTTCTGTGCTCAT
GTTTGTCGGCGGGTGAGCTGTGGGTCTTGGCGCTGCCGTGTGGTAAGGTTGCGTAACACTTTGGCGCTGGCTGGCGATGGTTGTTGAATTTTTTCACACC
TCTGTCTATGACTGTTGCTGTTTAGGGTCATTTGGGGGGACATTACGCCTGTGTATATCTGCTCTCGAGCGTTTGCGTTCTACATGAGCTTCAGCTACTT
CTGCAACATATTGATTGCCGTGTACACGTTGTCTGCAATTGACTTTTTGGGCCGTGGCTCCAATCCCGAAAAGAGCGGCATTGCTAAGTTCTATTTCATC
TTCAGGTATGCATTCAGTATTCGCTGCGCAGGTTCATAATGGTTTGATACTAACTAGTGCTGTGCGCTCTCATTGTGCCTTGCagtggcgttgctgcagt
atGTCTTGCTTACATTTACGGCTTCGTGGAAGAGACCTCTCACAGCAAGGCGGCACATACCAAAACCGCTGATGGCCAGAAGCCGCTTTTGGCTGAGGAA
GGCTAAGAGGAGCTGGGCGAGGAGTTTGGGGCACTA