Description :
From Genome Similarity Track
Location :
Scaffold_63:23234- 26744
Transcript NameFunction/comments
Hyaar_Emoy2807361hypothetical protein
Hyaar_Emoy2807362AAL162Cp (ISS)

Sequence
3510 bases(100 bases per row)
ACGGTGTTCGCGAAGTGCCGAATTTGCACAAAGAGCAGTTGCTCAGTATCCTCGAGACTATTTGCACACAAATGGGTCAAGTTGTGGTACGTCCCATTTT
TAGGATCTTTTTTTATTTTGTAATTTAGTCCGAAACAAAATCAAAATTGGTTTCGTGCTAATTGCAATAAAAATAATTATAGATGCAATTAGCCAAACTC
GAAGCCAAAATCCGTCAGGAGTCGTCGCAGAGCGGACGTTCGCTGCCTGAGGACCAGCTGGCGTCGTACCTAATGGGTCAGTTCGAAGAGGCCATGAAAG
CCATTGAGTCACAAGTGTACGCCAAGTTCCAGACCACAGAGGAGGAGGTGAAGATGGCCACCGAGTACTTTGAGGAGGACGATGACAAGGACGTGGCCAA
TGCCGTGGCCAAGCTCCAGGAGCTCTACCGCGTCATGACGGGCGGCGGCTTCAGTGATGTGGAGGTCCCTGCTGAGCTCACGCTCACGAAGTTCATTGAG
ATCATGCAGGAGACGATGGAGTCGCTGAACGTGGCCATGGAGCTGGTCTGCCTCGAGGTGAAGGAGCTCAATCCAGACAACAAGGAAGAGGCGATCAACC
AGAGATATGTAAAGCGCGCCGACAATTTGTCGGCGGAGATCCATGCCAAGCACGGACTCACGCGCGAGGTGCTCCAGGCTGCTATGATGAAGTACCAGCA
AGAACCGGCTTTCTTAATGGCCATGACGGAGCTTCAGCAGCAGCAGGCGGAGCGTTTTGCGGCGGCCGCCGCCGTCTTCAATGGAGAGGTGAACATGGGT
CTGACTGAATAAGCACGTACCAACAATATCTACTAGAAGAAAAGACCACGACACAGCTTCGCCCAGTTCAACTGTCACCACGTCTCCAGCCACCCCTCTC
TTTTCTACCTGCTTCCAAGATGTTCCCGACGCACGGGCACTCATTTTTGGGTGCCTTCACGTCGGAGTTGCGAAATTTCAAGTCGTCCTTGTCTCACTCC
ATTGCTCACCAGGAGCGAGGTAGCAGACGGGAGAGAAGGCTTGCGACCTTGTTGCCTTTTGATTGCATGGCTGTGCTTGTGCGTCGGCTACGTATTGAAT
GAATGAGTTGTGTCGGTCAACGTCGCACTCCTGTTTTGTTTGCTTCGATGCTACATGCTAATTTTTACTCGTTCGCCAAGACCTTATAGTTGTTGTCACG
TCGCTTTTCACAAGCACCTTGTACTATTGGAACCTTCGACCTTCGACCTAACAAAAGAGACCGTCATTTTAGCCTTCAAAGCCAGATGCTCGAGTCGAGT
GGTACCCCTACGATCTAATGGTAACAGAGTCGTGCAACATTTCGCGCAATCAATTTATTGTTAAAGCCTAGCAAGTTGACGAACAGGTAGGACCCATAAC
ATGATCGAGGACGATGTCCTTCTAGACTGAACGTGTATTCTTACGCTGTTGCCGATATTTCGGCGAGGATGCACTAGGTCTAATATACACGCATTGTTGA
CGTTGTAGAAGATTTTAGACAACAAATAGCGGTCAAGATTACTTCCGTACCTTAAGAACCACAGACAAGTTCCGGATAATCCATCGCTACTACCATGTCT
AACATCGACATGACTGGAGTCTTTGCGTCTTCAACCCATTTCATCTGGAGGATCGTTGGCAGCCAAAACTATGTATTTAATTTAGTAGCAAGTACAACCA
AGCTTGACCGATAGTCCTTTCTCATCTCCTGTGCACGCACGGTGATTCCTATCCACGCAAACACACAAAGACCCGAGACACGATACTGTACCCCCTTTCG
TATCACAAATGAGCGAGCGGCGGACCAAGCTGGCAATCTTCTCGTAGTTATACTCGATTCATGTCTTCGGTCCGAGAAGGGGTAGCGACACCTCGCTGAG
ACGGCGTGATGGAGCCATCCGTGCCCGACGACCTCAACACTGCCATGAGCTGCGAGTGGTTCAACGTGCTATTCCGCATGGCCAGCGCCACGCTGCCGCA
AACCATTTGGCCGTTGCTTCCCTGCCCCTCTCCTTCTATATCGCCATCTTCTTCGTCTATATCTTCGAACAAGAAGATGCTGTCATTCCATGACAGATTA
AAGTCGAACTCCGTCTCACGGATGGAGTTATTGGGCTGCTCGCCACCATGACTCAACCGAACCATCTCCGCCGGAACGTCCGGCACAACTGTCTTATCTT
GGAAAGCAAGAATCGCATCATCAATCTTCTTTGCCTTCGGAACGTGACCGCGTACAAGAGCTACAAGCTCAAAGCCTGACACCGACTGTTGCACGTCAAT
AGGAATAGCTTCCACAAGCCCAATCGGCTTCGAGATTCCCTTAAAGCTGTAATATCCATGAAACTTAAACTGGAAAATCGTCGACCCTGGTACGTCCTTC
AACACTTCATTCTTTGCAAGAAGCTGCTGGCTACGACAGATCGCTTGTGCGTCGCAAAACGCAGTCCAAGCATCACCACCAATAAGTACCTGGCCACCGT
GGGCAGCTTTGGCAATTCGCGCCGTCTGATTCACAATGTTGCCGAAGTAATCCGCGCGACCACTAGTTTTGTGTGGACTTACGCTCGCTGGCACGCCAGT
TTCGATTCCCATCGACATCGAAAACCGCAGCTCCTGATTCTCGTTCTCAAGATCCCACTCACGAAACTTTTGCCGAATGCGTATCTGAAACTCACCGCAC
CACAAAATAGCGCTCGCAGGTGTGAAAAATGCCAGCATAAAGTCTCCCTGTAACTCCTGACACTCGTAGCCATTATGTTGTCGCAGTAACTCACGCGCAA
CCATACACAATATCTTGATGCGGTCCGCAAGCTCTTCTGCATGGCAACGGACCAGTGGTCGAGCACCTTCGATAAACGTAAATACCATCGTCACTGGCTT
GTGTGCCGATGGAGCATCTCGCATACCCAGTGACAGCTGATGCGGACTTTTCATGGTCGGAAAGCGTCTCAACTCAAGATCCCGTGGTAGAAGCAGCATC
AGTAGCACTTCGTCCCCTAAAACAGCGTGGCCGCCCAAGTCCTCCACCACAGGGTTGCCCAGCTGGACAAGCTGTTCCTTCAAGCGATCCCACACGCTGT
CACTCAGCACAATCTGACCTCCATGTGCGTATTCACTCACCGTCTTGGTCCACTTCACAGCTTCACATAACGACAGCTCTGGAGTAATATCGGGGTCGGC
CGTATGGATGACCATTCGAACACGAAAGCCGCGGTACAGCAGCATATTCTTCTTCGTTTTCCCATTCGTCGTGACCGACACCTCCTTCATATCGTCAAAT
TGCTTCAGCAGCTTGTCGTTCCACGCGGCGTACACCAGACTAAGCTGGAGCGACAAGCACCACTTGGCGGCATGGAATTCCGAGGCAAACGCAATGACAA
ACAGCCCCGACCGCGAGTGACTCAAGATCTCCTGTCCGCCATACTCCGACGCCAATCGAGACAGCACCGTGTGCTCATACAAGAGCTTGGCGTCTTCCAT
CAAGTCTTTT