Description :
From Genome Similarity Track
Location :
Scaffold_5:2323326- 2330402
Transcript NameFunction/comments
Physo_303428dynein heavy chain
Physo_508724Hypothetical protein
Physo_508249Hypothetical protein
Physo_467441Hypothetical protein
Physo_510819Hypothetical protein

Sequence
7076 bases(100 bases per row)
GACAACGGATCAGTCGTTGGCATACAATAGGCTAAAATATCTGTTTCAAAAGTATCCTGAGACTCAAGCATGGAACATTCCACCAATTTTTCACGCTATT
TCTAAAAAACGTCAATCTACTTACCTCATCGGGAAAGACATGTCATACTTCACAGCGCGCGATCGAAAGGTAGTTCCCGAAAATCGTGTGAGAGAGTTAT
TCTCAGAGGTCGATTGGGTAGCAACCATGAACTGGGTTGAAGAACAGTTGAAAGCCAAGGGTTTGATGCCTAAGAATGTCGATACCAGTGCTCTCGATGG
AATGGTTGCTTTCCCAGGCGAACGACCCGCTGCAGAGGCATCTGCTGACGAACGCAAGCAATCTGCCCTCAATCGAATGAGCCAGCTAATCGATAAGCAA
AATCAACGAAGAGCTTTGGATATTTATAAAACGCAAGCTTTGAACAATTTCGGGCCGCCGAAACGCCCGCTTGAGGATAGTGCTGTCTCTGGCATCGATA
TTCAAACCAAGCGTCAGAATATGATGGAGTTGAGTCGAGTAGGAGCTTCTAACGAACTAATGATGGAGTCGGTAGGTAACGCTCGTAAGAACGTTCAAAA
TATCTATCAGCACAATCCGTGGCTCGTTAGAATCCATATTCCACCGACGGGGGTCGATCGCGTAAAGAAGAGCCGAGAGCAACTCTCTGGGTATTATCTA
GATGCTAGCGCGGATGTTTACAAAATGAAGACTCCGCCAAACGCGTCTAGCAACGACACGCGCCTTACCGATGCTGCAATAAAATATTGAATATTAGCTG
GTTAGCTACGTTTGAGGACCATATTTGCTACCTATACACTGTTATCGATTTGTATGAAACTCATCCGGACAAGATCGATGAACATCGTTTCAGAAGCAAT
CTCAGAGAGGTGAAAGCAACGCTATCATATTATGGCTTTGCAGTTGATCGCGATGAACCAATGCGGATGGAGGATCTGGAGATGAAACCAGCTGCTGTCA
GTGGTCGAGGATTACGAGGCGCCGGATATGTCAAGCGCATGCAGGACCTCCGAGACAAGGATGGACGCCCGATCAAGTATCACTCCAACCGAAGGTAGAA
CCTCGCGCAGCTAGAGGGCTCGGGAACCGCTTCTGCTCTTGCATACAAGCGGATTGGTACCAAGTTTGTGCATCTACCAAAGCTCAATGACGGTCTCCTC
AAGGTTGTATACCCATACCGCTCGACAGTCGGTCCTCAGCGCAAGATTAGCGATGACCTAACAAACCTAATCAAGACCTTGGTATTCGATGCCAAGATCG
ATCAACAGCTCTACGACTCGATGTCCGTGGATGATCGACGAGTATTTCACGAGCTACTGCGTATCACACATACCCAACACGCGCTACGCGATCCAATCAA
GGATCCTCGCGAGGTACTGCGGCAAGAGTACATCAAACTGAGAGGAGAGCTAATGCTCGGCAATGACAACCCGAGCCTGATCCGCGAACTCAAGTAAGTA
TTGATCGACATGTATTCAGCAAAGCTGATTTCGGATAACGATTTCAAGGAGGTTTTGGTTGCTATTGTATAGAAATATCATGATATTCATCAATACTAGA
CTCGTCGACACGAAGAAGCGTACCAGCGCAACCTAGAGGAGCTGAAATCGCTCATGGAGAAGTTGGTAGTGAAAGACCCGCCTACGGCTGATACTACGTT
TAAAGCAGCTAAGCCAGGCGGTAGTGTATGGACATACACTGAACCCCAAAAAAAGCCGCATGTTTAAGCTGTAAGCTCTCTAAGCAGAGCAAGCTCTTTT
TTTAGCTCCTCGATTTGACCTTATTGCTCTTGGATCGCTCGCACTAAAACCGATGTCAGGCTAGCTAGATCAATTCCCCATGGGTTAATTGGAAATCCTT
CTTGATTTGAATCATCGTTAGCTCCGATATCAACTGCCTCTCGGACGATTTCGTATAATTCTTGCGCTATGAATCCTACATGAGAGGTACGCTCCTGTAT
CATAGTGAATTTCCTTGGCTTCATCTTCATAACTGTATTCAGGCCACATGGACAGTCTACAATGTTTGGCTTTAGCCTCTTGTCCGAAGCATTAGTGTAG
CTACCACCTCGCACCGGGGTATATGATACCCAAATATAGTTAGCATCGCAGCTCCCTAGTCTGATAGCACCTACGGTCGAGTCAGAGCCAATGGCCCGGC
TCCAATTGAAACGGTACCTAGCGAAGCCATCTCCGCCTCCCTTGATGTGCATGAAATTGTTGGTCCATATCTCTCCGCCAGAGTGTATGGTAGCTTCTGG
CGATGTGACACCAACTCCCATTCGTCCAGAGTTGTTGAGGTAAGCAATAGTACTATTGTTTACCATGAGACGTAGAGGATTGCTCGTAGTAGTGCCGAGA
GCAACGCCGTTAGATCCGCCAGCCACATCGTTGTAGATCTGTACCTCGAATTCGATAGGGGTCGATTGATCATTAGCTATGTGCATCGCGCGCTGCCAGC
TACCGGATAGTAGATTAGCGCTTGATGTGATATCCATTTATGCGGTTGATGTAGATGATCCAAAACGGATATAACCTGCCTGAGTGATACGCATGCGTTC
AGACATTGGTGATAATGCATTAGCTCCTGACCTTGTACTGATTGCAAAATCAGCCATTGAATATTGAGTACTCGTAGCGGTACAGTATAGATTAACGCTA
GGGGTGTACGTTGTCATATCACTAGTACCTTCAATCGTGAACGATATTCCGGCCTGAGCACCAACAGTATTGCTTTGATTGCGAATACTAAGATTGAAAT
CGCTTGCCCTCGTTGTACTTGAAAACGTCGTCCCAGGCGTTATCGATAGAATATTCGTTTGCGGCGAGATTGGTACTCCTCCAATCGTGAGCGATGAACA
GTTGAGCGCGCCATTGACATCTAGAAGGTAGCTGGTATTAATAGATGAGCCTCCGATATTGATGTTCCCGCTTGTGACCATGATCAGACGGTCTGACAAA
GCATATTTGAGAAAGAACTGATTTGCTCCCGAGGTATTCGCTGACCCGCGAACACCCAATTCGGCCTGGTAGAAGCTCACAAAGTTCATGCTAGCTGCTG
ATGTAGTAGTGTCGTTTTGAATGACGAGAGACTTCGAGAGACCCGATCCAACTACTGAGAGGGATCTCAATCCGGTAATACCATATGAAGCATCAGCTAC
CAGCGCCTTGCTTGCCTCAACTGTTCCTTACTTTTGGCGTTTCGCAAATACCGATCAGCTGCTGATACACATAAACGGCAATCTAGCTATAGGTCAAGCT
AGTATTAATACGGCCTATAAACTTGATGTATCTGGAGCTATTCGCGGGTCTAGCTTCGTTCAAGGAAGTACTACTTACGATCTCTCTCTTATTCCTCGAC
TATCACTAAGTACGTATGCCTTGCTCCATCTGGTAATAGCTCACGATAATGAGATTGACTGTCGATGTAGTACTATCATTCTGAATGACCAATCCTTTGC
TAAAACAGAATTTATACTCAACGAACCTGGCGTTCCAGCCGATGTGATGTTAGGCTGTGCCGCGGTTTGTAGCGTACCTGTAATAGATGTGGCTATAAGC
GATGCTGACGTACCAATCGATGTGCTATTAGGCTGAGCAGCGGTCTGTAGCGTGCCTGAAATCGATGCTGCAGCAATTGAATTGATTCCGGTCAGCGTTC
GGTTAACACCGGTAAAAGAGAGATTGCCTCCAATAGTTAGTTCACTCAGTGTTCCTAGCGATGTGATATTGGGCTGTGCAGCGGTTTGTAGCGTACCAGT
AGTCGAAGTAGCTGTAAGCGATGATAGGCCTCCGATTTGACCAGTAGGTCCGACGATAAGCGCTTTACTATTGCTTGCGGTACCAGGGCTCGCGCTTAGT
AGTGAGAGGCTGCTAAGATCGACGTTAGGGCCGTTCAGCTTCATCGAGCTGCAACTGATCGAATTGATACCTGTTATATCGAGATTGGTATCAAGCACCA
GGGCTGACATCGGACTAGCCACTCCCATCGTGATCGAGCTGAGATAACTCAACCGAGAGTCAGTCTTACTGAGATACAATGAATCAGCCATTTCAAGGCT
TAGAACATCTGTGCCTACCGCATAGAAGGTTGGGTTAAAAATATTCGATTCTTGAGATGGTGGCCGAGCTGTGAAATCCATTTTTTGTTGGCGAGTTATA
TATCACTAGATATATACTTTCCACAATGGTTAATAGGATTGATAACTGGGGAGCCGCTCTCCCGAAAGAGTTCCGCTCAGACTCTCTCGGCGATGTTAAG
CAACTCGGGATTAAAAAGCTCTTCCGCGGAATCATCCTAGCTCCCAGCAACGCCGGTAAGACGAATCTATGCTATCACATCGTCAAGAACGCACCAAACG
TTTTTAGCCATCTGCATCTGATTGCACGCAACCCAGACCAGGATTTGTATAATTATATGAAGGAGAAACTTGCGGGATACATAACTGTCTATGACCCATC
GACACCGCCAAGCGTCGATGATATCCAGAAGGATCCGCGAGGTGGTATTCAGCTCGTTATCATTGACGATTATTCATCAGACAAGAAGATCCAAAAAGAC
CTATTCAGTCATTACTTCATCAGAGGGCGCCACAAGCTGCTATCTACGCTGTTCCTGACGCATTCATGGTTTGCTACTGACAAACTTATAAGACTAAATA
GCGAATATTTGTGGATTCTCAAAGCAAACAGCCGACGCGATCTGAAGATGGTCATCTCTGATTTCAGTCTGCCCGGTCTTACGCTCGAGCAGCTAATCCG
AGCCTACAATGCAGCCAATAGAGAGAAAGGTCAGTGTGTGACGGTCGATAACGTTAGGAGCGTTCTAAGGTATAATTTCAACGAAAAGCCGATCTATCTA
AATTAGCATTCGGCAAGAGGCGCGAGCCTCGAGCCAAAGGCTCTAAGCTTGCTTATTGAGCAAGGCTCTACCAGGGTAATAATTAATATCGACCGAATAT
TATAAATATTGACATATAAACAACCATGTCAAACATCATCATTCTCAGCTCGCAGCACATCGTCTCTAACGGTTACAACAACACCCTCCGCTATGAGTTC
CCTGGCAGCAGCGTTAATTTTACTAACAGCGAATTGGCTATTCACTCAATCAACATGTACAACAGTCAATTCAATATCGATGCATCAGCATATGGAAACA
ATAGCTTCAAGCTTTCAATGCCCACAGGCAACACCTACAGTACTGTACAGATCAGACTTCCGAGCGGATACTACTCATATAGTGCAATAAACTCAGCTAT
GCAATCGGCTATGATCTCAGCAGGTGCGTATCTAATCAGCGCTGATGGCGATAACGTATTTTACGCCAATATCAGCGAAAACCCAACCTATTACTCGTGC
CAAGTCGATCTATCGCCGGTTCCGACGAGCCTTCCCGCTGGATGGTCTCGCCCGCCTTCTGGTCTCTACTCGAGCGGTGGAACCGGCCTGCCGCTTGGAT
TCTCGTATGTCCCCAAGCTCGTTATCGATAACGAGGAGTTTGGCAAAATCATCGGTTTCCCACTCGGAACGACCCCCAGTCAGAGTCTATACACGCTTCA
GTCTGTACTCTCTCCGATTCCGCCTCAGATCAATCCTGTCAGCTCATATCAGATGCAGTGTTCCCTAGTATCAAATCCATTTTGCATTCCAGACGATATT
CTCACTACTTTCAACACAGCAGGAACGACTATCGGTCAGCTAGTAAGCTACCAGCCAAATGAGTTCTGTTGGGTCGATGTTCCCAACGGATCATATGCTA
GCATCACTCTAACGATCGTTGATCAAGAGGGCAGGTTCGCTAAATTGAACGATACAAACATGCTGATCAGTCTGATCGTCCGGCAGAAACGCTCGTAGCG
GGTTAAAAAAACAGTGAGGTTTTTTTTTTAACTATGACCAACGGAAGCTTCCAGTTCGCTTAGAGCTACCACCCTTGCGCATAGCGCGAAGGCGAGCCAT
CTTCGCCTTCATCTCGGGGGATCCCTTCGCTGGGTGGCTACGGCGAGAGGGTTTAGCCTCAGCAACGCCGATACCTGTAAATCGCTTCAGAGCGCCTCGG
GCAACACCTACGAGAGCAGGGTATTTGCCTTGGCTCGCTACATACGCCGATCCCATGCTGGCGAGACCATCCGCGGCAGCGGACAGCGCAGGCTTGATTA
CAGGCCTCCAGGCACTCTTGATGCCGTTCCACACCTTACGCCAGATACTCGCTCCGTGCATACCAGAGCCGCTCTTGACCTCCATAGGGTATTCGATCTC
GTGTTTGGTGATCTTGACTCGAGAGCCCTTGCCGGCCTTTTTAGCTCGCATTACCTTATCATATGATTCGGGGTGCAGATGTAGCGTTGCACCAGAGCCG
GCTAGATCAGCCTTAGTCAGCGATAGGTTGCCAGTCTTGACCGCACTGCGAAGACGCTTTTCGGGGATTGAGTTCGAAATGGATAGTTCCTTGTACATCG
TCGTTAATAGTATAGTTACGCAGGGATTTAAAATTTCAGAAAATTAATTATCGATTACGTCGATATCGTGATCAGTGAATCTATCCATTAGATGCATTTG
CCCATGCTGCTTGGCGTATAACCATAACAGGCAGAAGATTCCGCAATATTCGTCCGATGAGCCTTGGATTTGCTTGTTGAAATATAGCAGATCGCCTAAT
ACCTTCGGCGGTCCGACAGACATGCTATCAAAATAACTACCATCACACACAGCAGTCCAATGGCCGATTCTCGGGCTCGTACGCAGTAGGATAAGATATG
ATCCCTTCGAGGTGAGTGGCTTCCGGATCTCGGAAAGCTCGTATATGCCATCGATCCGGACTCCAATCCGCTTAGCGAGCGCGAGCAAGTTATGGTCTGA
GGTAACGCCTTTAACAAACTCCAATCTCCAATTATAGTATCGCCAGTATAGACAAATTAAAGCCCCCGTAACCTGGACATCTTACGTTTTCAATCAACAT
ATTTTGATCTCTCCAATGTCCAGCCAGCAATGGCTGTAGCCTCCGTCAAGAGATTTGAACACGAATGCGTATCGCG