Description :
From Genome Similarity Track
Location :
Scaffold_2:23231- 24330
Transcript NameFunction/comments
g1295.t1hypothetical protein

Sequence
1099 bases(100 bases per row)
ATGAGTATCCACCCCAGTGGTACTTGTGCTGGGCCGTCCTCTTGTCTCCATCAGCTCCAACCTGATGCATCCTTTATCCACTCAACAAGACGTTGATCTC
CTTGTGCAGCAGCCCCCAACAGCAATTTTGCCGCGTATTCTCGGTCAAGCTGAGCATTTACCTTCAGCCACTCGATCACTTCAACGTCGTGCTTCCAGAT
CGCGCCACAAATTTCCATGCCACCTCGGTACCAGTAATCCCAAATTCCGGTGGTCGGCATGCAGCCCTTTCATAATTTCCAGATGTCCTCCTGCTGAAGA
TGCACTTACTGTCTTGGTGCGCTCGACAAAAATATTCCACCAGCCCTTTGCTTAATGGGTTGAGAGTGCTCATATCACCTTGTGCAGAAGCCGCATCGTT
CAAAATGGGCCGTTGTAGCTTGTGTCACGACTCGGAGGTTCTCGAGCGCGCAGAAACTGCAATGGCCGACACGAGGCGCAGAGTGTGTATAGGTGTCCAC
TTCAGCGAGAAGACGTCCAGAAGCTCGTCGATAACGCGTGTCATATGGCCCAGATCTCTTGTTTCGGGACGTCAAACACTCATGACAACGTGACCTGAAG
GAAGTCGGCAGGACTGTTTTAAAATGAAGGCGGTTGTGGTGCACTGTGCCGAAATATTACATAACCGCTTGACCCGGGAATGGCCATCAAACCAAAAGCT
ACTCGCAAACTTTTACTTCGAAGTATCTAAAACAATGCTCGGCGTTGCAATAAGTCGAGGATAACTTACAGTTAGGTTAACCTGAACATTGACCAGTGTG
ATGATTCATCTATCTTTCTAGATTCAATTTCGTCCTCGCATATTTCACGTAGTAGTCGAAGTTTGCGTGACGTACCAGCGCCTCTCCTGATACCTCCTTC
ATTCCCAGCGCCGTTAAAACGTAATCGTCGGATCTTTTAGTCACTCCCCAAATCCACGCTCTCTCGAACATCTCCAGCTTGGACGCCTCACTATCAAAAT
TAGTACTCACTAGAGGGGGCGTCTTGCGCTTGGCCTTCACTGCTCGCATAGCATTATCGTCAAAGATATTCACATAGCGGACGTAGATCATGTAGTCGT