Description :
From Genome Similarity Track
Location :
Scaffold_2175:2323- 4139
Transcript NameFunction/comments
Phypl_g14776hypothetical protein PHYSODRAFT_534001

Sequence
1816 bases(100 bases per row)
ctgctgctcagcaACGTGCTGGGGAAGGTATCGCATTTTCGCGCGCTGGTTAATGACGCCTCTGGCTGCACTGTGGTGAGTCCTGCCCCTGAGGATACCC
ATCATTGTGCTCTTGGGTGCTCGATCTGACGGGAGCTGAGCACGCCAATGAGTCGCGCTGCTTTTGACAGCTAGAGCGCATTCATCCAGTCAGCTCGCAG
GATTCCGAGAGTCGCCGATAAGAGAAGCATGACGAACTGACCGCTTCAATTTGTCAAATGCTCATCAAATCCTTTCATTCTTAGCCACAGCGTGGACTGT
GTCGACAGAAGGCATTACGCGTACGCGGGGTATATGCGGAAAGCTGGATCTCCAGCAAGTACTTCATAATCCACTCACTCTTGATGCCTGATGGTCTCCG
CTGCGTCATCCTGACCTCGCGCAGCCGCTGGGCGTGCACATCGACCCCGAAACCAATGCGACGCAAGTCAAACGTGACGTGGCAAATTCGTCGATGGCGC
GTTCATCAGTGTCGTCAAGGTCGCGACGCGAGTGAGTGTTCTATTTCCAGGTCAGTTCCGTATCTGATCCATAAAAGTAACCGATTGCAGCAGTCGTGAA
AAGTGAAAAGTATGCTGCATATCGCAAGCTCCAATACAATCAGCATTTACAGTAGACTGTGTGCGCGCTTCGGATGTAGTCGCATTAACCAGTGTTTACG
ATAAGGTGGGGTGTACTTGAAGGAAATATCTAACAGAGTGCACTCAGTTGAAACGAAGCGACTTAAAAGTTCTACTTAGTCGGTTGCAGTGTAGCATAGC
CCGGAACCCCCACagaaggaaaaaaaaaaagttCTGGACACGGCAGCGGGTCCATTCGCTCGAGAACTCGGCGCTGGGGCCGCTTACGCAAATACCGagc
ggccctgcttcgcgggcacCCCGCTCAGGTTTGCTACGGACCGTTGTCTAGGCTCCTCTGACCCGCTCACTACCGCAAAACATATGTTTTCCATAAAAAA
ACAGCATTAAAAATCTGTTCCATGCCCTGGTCAGTTCCGAATATTATCAATTTAGGAATTTACCGCGAAATCGCTCTTGCATGTGTTGTGCTTGTAAGAG
CAAACAAATACTGCGTAAGTCTATCACTTCTTAGCGCCATGCTCCAACTCTCATACTAGTTGCTAGAGAGTTACTCTTTCAGGCAGCGCTACGCTCGGGT
GTTTTGCTCTCCCTGTTGGTGTTCATTCCGAACTCCATCCTGTTCATCACCACTGCGAAGAAAAATGTGTTCACGAtcatgagcgccacgagaGTAAAGA
ACAAATACTCGAGGTGCCCGTTGTTCAGGTTGGCCGGGATGTActtgccgaagagcagcacggtGATGGACAACAGAGAGCTGCCCATTGAGTTCACGAA
GAACGCGAGCACGATTGACGTGCTGCGCATGCTCTGAGGAACCTTTGAGTAGTTACCGCGGCGGGGACGCTGGAAGGAGGAAGCTATGCAAAGTGCTTTG
TGGCANACAGCGCCTGGCGGTACCGTCCACAATACACAGTTGGTGGATGGACGATGTTTACCTGCCTCATGGAGAAAGCTGGTGGGGGGACACCGAAGTG
CGGATTGCAGCTGACCTAGCTCAATCTGAGTCGTCTGTTGTTTGGGGGGTTCGACGCTGTTTCACGTCTTGGAGGAAAATGGATTGTACGTATTCCATGT
GGTCAATTACGCATGCGCACTGATTACACGGTGgtccagcaacagcagcaaccccGGCGCCGTCTTACGACAACGAATCCTCTGGGGATTCCtgcgcgca
gcagccggaaTGAAGG