Description :
From Genome Similarity Track
Location :
contig_58:232273- 233810
Transcript NameFunction/comments
g10436.t1hypothetical protein

Sequence
1537 bases(100 bases per row)
CCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTC
CGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGAGGCCCTCCAACGACTGTCAACAGTCA
TTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGC
TGCTCGAACTTCGGTGTCGCCATCGGCCACGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTG
TCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGC
GTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGA
TCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGAT
TGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCA
ATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAG
GTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCA
CTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAG
GCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAA
GCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTT
CGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGA
AGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCAT
GCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGG