Description :
From Genome Similarity Track
Location :
Scaffold_63:232227- 235887
Transcript NameFunction/comments
Phyca_LT153420401f420-dependent nadp reductase
Phyca_LT1534510592Hypothetical protein

Sequence
3660 bases(100 bases per row)
caagaccaaaaccttggtacgcacttgctagttatttagaatataatctaagtatcgatcgtctgcgttgttctggagtgtgagatgaagttcgggccta
ccttcagcaacactttctgctgcactaacacactttcttcacccacgcagcggggatacaaccctcaactcatggcatctgtacgctgccgacatcggaa
ataaacgctctcgtgcagaagtttctataagcactggtccagcgccgctggatcagtcagcattgttctggatgtgaacacagagggactggttggcgtc
ttcagctacttatctggcctgagtttggtgctcaaagagacgttactacgaagtccgagggtgggcccacggtttcaatgctgtcgagggttgtcaacga
gggcccgtagcgacataatttacagaatgagactacggtacagcacgtgtattatacgttattcgcaaatcaactggtctagattagtcgccactctggt
tagtagcactcggcggtgacagagtttagtttagtcaccacgtcgaagattgcatctacagcttgactcatttgcccatgggcgtgaccccttgaggatt
ctattcgaggtttcgagttcattcttcaattgtcgtcttcaagaccacatcaaaaacactcaagtcatccaaccaaacatgcgcgtcgccgttgctggaa
ctggatcattcgccaagtatttcatcgaagaattccccgccgctggccacgaagttgtcgtcttgactcgttcgcacaaggagttcttggatggcaagag
gggcgtcgtggaacagcgtgtcaccgactataagaccgtttcggagctcgtggaagtcctcgaggactgtgacgcactcgtcagtacgatcatggacatg
gaaagcccaagcgctcagactcacctgaatcttctcgaggcttgcatccagtcgcccaaatgcaagcgcttcattccatcggagttcggcggaaatgaag
agaatttccccccggaggaatacgatttcttttatggtcataataggccgctgaagaaagctctcaaggagcagaacgacgtggagtacacgtttatctc
gctcggatggctcgcggactatattgttccgagttccaacagataccacagtgacatcggtcctggccacccgttgaatcttcacacgcgcaccatgacc
atccctggtacaggcaatgttatgttctcacttaccagtgcacgtgatatggccaaggctatcgcggagcttctgaaaagtcctaacaaatggcgtccgt
acacgtacgtacaaggatcggagacaacgtggctgcaaatagccgaactaatgaagacagtcggcgggatacccgacctcaaggtgtcgtttgagccact
ggaggagattaaggagcaactcaacaaggaagagttgtttttgaacgccagtttcaagttgttgatcccgtctggtcggtccacatttgaccaagaagca
gttaagcgcgaccacgctgagcacttcccccgtgttcacttgcgcacggtcaaggaactgcttgaagcggtgaaggaggaccctgaggttattgtctaga
cagccacccgatagcgctttcttagctaaaagaatctaagacaggaatgaaacgcttgttctgctgttctttttgcatggtgtagcaactacgtgtatct
acacatcgctggtctgtaccaatgttcctccgctgttgcggctatagctctcctctaacaaaaggttgtctgcacttgagaggatactttcaatgcatac
atcagttactggcatgagtgcagccaagacatcgctagcatcaccgatccgatccactgtttcgagttgagattggctcacaaccgtgacgaccgattct
aatccaccagaaggggatcgtgtcaccgcaccccacatcgtatcgcgatactcgatgcattcatcagcgagtttggagatagactgccacacgaatatgc
tggcgttgtagggagcacccatttccatccggtggacaacggcgtagtagtcgagatcaccgaggcctcttcgtatttccccccgaaacttcatagcgca
gaagtttggcgatcgctcgagcacatgtactattggaatgacgtcatgacctgaattctcttccgatgcaaaacttgtgtctggatttgtgagagcttcc
cagatcacagatgacgttgagtgcattgcgaaaggaacgcttcgcacacacactaaggtcgactggaagtcccccgtttggacatgagaccatatatcct
tatccggctcaaatccgccgtttccattcggaaattcaatgccatttgctgcgaacacactcggtaactgcggaaccgctgcctctgctcgttgcttgag
ctgattcagcacgagatcgtcctccattttctgctgtagctttgcaattctccccatgctcaaggctgtgttaactcgtcgcttttcgtgcaagagttcc
cacaggcgctgaatccagtcagcattgctctgtacctgactgtttagaattcggttggtgttctccgctttttgtcggccacgagcttgacgctcggaga
agcattgccacgctgatctcgacctgctatgagcctgtgatccacgacgcagtgtcgatacatgagcctccagctcagagacgagccccctcaacgtgga
gagctctgctttctcgcggtctcgcgtcgagtttcggtgccttggcttgcgcattgaattctgagaagaggaaaaactcaaatggtacagtgtaccgatt
ttacagttacatgcattctagagtttgcggaatgttggtttgcaacttggattgtggagaccaacagcaccacacgcgccgctgccaacttggcggtcac
caactgcagcttctgtgcgcgtggcttaaatttgtgcattatttgactaacgggcgtacacactcacacgctgcaatgattcatcctggtccccagttgc
tgtccacacgatgcagcgcccattccaattcgccagaatcgtagttggcatttgtgcggtcaccgcactgcggtggacacctatgcaagttgagatccac
actgagacagagctcctcgtcctgagcacactgagccacgcacgtccagcaaatcgccgtgaaaactacacgcgagattcctggtttggtggcattggaa
tctggagatccgagagccgtttctagttcagaaaatgaactccagcgccacaacactgcagctcagaggaatgaatgtctcgcagcgcggtggtggcgga
caagaagttacggccttcgactgcggaagtctccaccacccgtgcaaaaatgccatcggagtgacacggaaaccacgcccagttcttgtgcaaacacgtc
agtgtcatcgtgagggaagcgtaaggcttgcattgcaagttggaagcccaagtggtcagtctacaggcgctaaaaatgacttcaccattatgcgcttcga
acagcattgctacatgtgcatgtacagtagtggcaacagtatccttgtggtggcagggccaatgaatcaataatgtcgctgacagcactgcggatgtctg
cctaggtaaaaacagaaagctgcggtccacccgctagaagatccgcccatgaggagctac