Description :
From Genome Similarity Track
Location :
contig_151:2322- 3521
Transcript NameFunction/comments
g14360.t1XP_009514041.1 hypothetical protein PHYSODRAFT_466574 [Phytophthora sojae

Sequence
1199 bases(100 bases per row)
AGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTACGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGAT
GCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCA
CCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCAC
CAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACCACTGAAGACGTGTCTCTGACTGACCCCGTTGGCCCCATGAGC
GAGGAGGTGACCATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACG
ACGCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGA
CGGTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGT
TGTGAAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGA
AGATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCTGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGG
CTGCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCAC
TACTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCG
GCGAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCT