Description :
From Genome Similarity Track
Location :
contig_51:232167- 233700
Transcript NameFunction/comments
g10602.t1hypothetical protein
g10603.t1hypothetical protein

Sequence
1533 bases(100 bases per row)
GATGTCTCCACTCAGTGAGATGTTCTTGTCCATGTGGAACCGGTTGGCGAGCACCTTCATCAGTGAAGACTTGCCCGAACCAGGCTGACCCAGGACGAGT
GTGATGCGGCCAGGCTTAAAGACACCAGTGACGCCACGCAGGATCTTCTTGTCCACCGTGAGCTTGTTCGCCTTGGACGAGCAGAGGCTGCCCAGTCCTT
GCTGCAGCTGCGTCCAGAGCGTGGGCACTTCCAAGCTGCCGCTTTTGAGCTGCGGCACTTCCGCCGACAGCTCGAGGTCGCGGAAGCGCACTTCAAGGCC
AGGGATGGGGTGGCCCAAGGCGTTCTCAATGACCGTCGACAGCGTCGAGTTCATGGTGAAGACGTCGTCTGCCATGAGTGCGTCGGCACTGGAGAGGTCG
TCCTTCGTCAACTCACGGGGCTCAGGGAACATGCTGTTGGTGCGGGGCAGGCGGTACGTCGACACCTTCGGCGCCAGGAGTCTGTCAGGGACAACGTCAC
CGACGCTTTGGTTGTCGGTGGCGTCGTCGGCGTCGCTGTTGGTTTTGGTGGGCGGATGGTCTTCGCGTTCCTCCATTGCTGCGTTGGTGATCCGAGGCGA
AATGGCGAGTGAGCTTTGGCAGGGTCTGGTCCAGTTCCATCGACGCTAGACAACCGACAGACGCCGCCCTCGGAAGATTTGAAAGGTGCAGCAGCTCCGA
TGGAGATGCACGTTCAAGCACAGCGCCAGTGCTTCGGCAGGGATCCGTTGGCGCCAAAGACGCTCGAGCTAATCGGCGTGAAGACGACTTTTGTTTGCTT
TATGCGTTTGTATGCGGTGCCAGCGCGACATGGTGAGACTTGTTGACGTGCCACCAGTGCACAATTGGGGCAGTGCCTATCGTTTCTCTGGATCTGCCTG
CTACAGATGGTCCAGCGCAGAGGGACTCGAGCAACGTGGTTGTGATGCAGAATAGGAGACGCCTGGCAGTGTGTACCCGCAGTCTTCATCACGCTTTCTC
ACTAATGGCAAGCGGAACGGATATGCTGGTTCTCTCCGGCTGCCAACTTCTTGTACGAGGAGTCTTGCATTGCTGAGGGCGGAACAGCGCGGGCGGGTTG
TGTATTGTCGGAGGAAAGACATCAACATTCTCGATTACGCGTGGGGGATGAAGTGTACAGCACTGCGCTCTATGCTCCATGTGCATTTATTCTTGTCGCG
TTGAAGCACCAAGTGGAAGTTTGAGTTTCGCCAGACAAGGAAAGTGAGGAAGACGTCCAACGCACGAACGCTCGAAGTACATTATGATCCACCAAACACT
AAACAACAACATACGCCTACCACTTGAAGTCGAACGTGAGGCACGAGCGCAGACTCGGGAGGGCATTCACCTGGGCACGGAGCTCTCGACTGGTCGCCGT
TGCCCCGCCCCACAGCCCCGCAGCTTGTTCCGCGGCCAGCATGGAGCTGTCGAGCACCTCGGCCTCTCGTAACACCCGTTCTTCCGTGAGTAGCTCCAAG
TATCGCTGGTGGACCGACACTTTCGCCTCGTCC