Description :
From Genome Similarity Track
Location :
Scaffold_49:232105- 236050
Sequence
3945 bases(100 bases per row)
CGTTGTGTGCGGAGGGCTTTGACGTCCTTCGCGTGGTCATTGTAGATGAGCAAACTCGGCATCCACCCCCTTTGGCATGATTGACGAGTTGTAGATAACC
GATCGAGTCGGCTGCCGCTTCCAGTGCTGTGTTCAGCGTTGTTATCCAGCGTTGGTCCGGCGTTCCTTGGTGAGGGGGCGTGGTTGTAATCATCGTCTTG
AGTTGCTGTCGGTATTGATGTTTTGAGTTGTAGTCGTGCACCAGCAGATGCGTCGCGAGTCGGGTGTCGGCGGTGTTGAGCCGCGTCTGGCTTTGGCTGC
GGCGCAGTCCTCGGAGACACCGGATGTTGAAGTCCAGCGTGACGATCGTGTGGTCTGATGGCGTGAGGGTGCCTCTTCAAGACTGAGCATTTTCACATAG
TGCTTTGTTCCGTTGGCTGCAGAGAATGTAGTCAATTTGGTTGAAAATGCTGTAGTTCCGTAGGCGGTGTGTCCATGTCGTAATGTTGCTTGCACGCTTT
CGGAATGCTGTGTTCGTAATAAACAAATCGTTAGCGTCACAAAATGAGGCGAGAACGTGACCGTTGCAGTTGCACCGGTCGCGTCCTCATTCCCCGATAA
ATGCTTCTTGGTCTCGTCGTTGGCCGATTTTCGCGTTGAAGTCGCCGAGGATGAACGTCGTGTCTATTTGCGGGAGCTTGGATAGCGCATCATGGATGTC
CTTGTAGAATCGGTCAATCTCGGTGGTGGCGTAACCGCTGCGAGGTGAGTACGCATTAATGATATTTACACGTTGAGCTTGGAGAAGGCGGAGTTGGAGC
ACTCCAACTCGGTCAGACTGGGCCCTGTGTTTGTGAAGGAATTTGTGCAGGTGGGGAGCAATAGCAAAGCCGATGCCGCGCCAGCGGTTGGACGTCAGGA
GGGCCAGGAGGTGGTACGTACCTGTCTTCTGTTCGCTCTGCTAGGTGATACGAGTCTCTTGTAGTCCGAGGATATCAACCTTGTAGGTTAACAGGTCTCT
CGGAAGAGTCTCATGTTGCTTGCGCTGGGAACCAACGGACTGGACATTAAACGTACCTAAGGGGAGATTGCGCGCTTGTGGCTTCGGGCGGAGGCGTCGT
GACTGCGTAAATGAGAGCTGGGGGTGAGAGAGGTTTTTAGAGAGAGATTCGTAAAGGGAGAGACCCGTGAACGACTGACAGACGCGGTGAAACGTCTGCC
AGAAGCGTTCAGCGAGCATCATGCCAGCTCAGGCTTCCCGGGAGGGCGTCACCCCAACCCGACCAGGATTTTTTCTTGACAAATGGGCGATAATGTGGTA
TCTAGATCTTTCTATAGTGATTTGCAAATATCAAGTATAAACGTGTCCGTATTCGATCGTCCTATGAAATTTTCGACTCTTCGTGCAGGCTCCGTCGGTT
TGGGGAGTCACCGAAGACTCCCAAACAGACAACGAAGACTCAACGACAGGCGTCAAAAACTCGAGTATTCGGAGGAGTCAAAATACTGAAAACACCCCTG
ATTGTGAGCTCCGACATCTGCAATTAACTCGTGACACCCGTACACGAGAAAGGATCGCTGTCAATGCCAAAGTGTCTCACGGAGGACACAATCTTTTTGG
CACACCAGAGAAGGCTCCATCGCCCCTGACAACACGAAGCAATCGCGCCGCCTCCGAGCGCGGGCCCTGGTCGTAACAGGATAAAAAGTGCCCCCCTAGT
GGTGGGCATCGACAGCATGTTAGCATGAGGAGATCACCTGGCAGTTCGACACCAGATACTGCTCGCAGTGTTGCTGCTGACGGCGCTCTTCGATAACACG
ACGCTATGGTCGCTGCCCCGACAGGAAGAGGAGACACGTCAAAAGATGGACAGCAGGCGCACTGCCCCTGACAGGACGACAGTAGATACACTGCATCAGA
ACGACAAGCGCGCCGCTGGTACTGCGAGACTGACTTTGGTATTGTTGGGCTGGTGTTATAACAGCCTGTACGCGTACTCCGAGTCGTGGACCTAGCGAGA
GGACATCTTGGGCATCGCCAGAGCGTGCGTGGAGTTGTGCGTTTTTTTATTATTTGCTGAATGCTATCGGAACTAACGATTGGTTGCTTGCAGATCGGTT
GCTTGCGTGGGCATGCTGACAATTTTGCTCAACGACTTCTCGATGCTCAAGTACTTATTGTTGGGAGGGATGGACGTGCTGATCTTCACACAAAGAGAGT
GACACGAGCTACGATAGAAGAACATCATGAAATGCTACAACAAGACAATGCGTGTGCGGCATCAAATACTCATTGGTCGCTGCATCACCGCGCGTGCAGT
ACTATCGGCTCGCGGTGCTGCTGCTTCTGCTGGTCAGAGAAATACCTTCACATGAAAAAGGAACGCGACGGAGCTGTGACTAACCTGGAATATCCAGTTC
GCTAACTCTAGTGTTTGTATAATGCGTGCCGGTTTGATGTAAGCCGACCAGGAAGAACTTCATTCTCTCGTCTTGATCGCTTCGGTCCACGGTAGTACAA
CGTTTGCCGCTCGTCACTTTCAGCAATACCACGGAGACGTACAGCATAACCTAAGTGAATTCAGTGTGCAAACTTGAAGCAGTAACTGAATGGGCAGCTG
TGCAAGTTGATCTTAACTTTCCATCTGGTAAGTGACATGCCATTCAACTTCATACGACCGGTGTGGGCCCCCATTTTGCGCCGAGACTAATATTTGCTCC
TCTGTCTTGCCGACTTCAACTTCACAGCACGGGTGCAGAGCGACGACACAACACGAATCGCGCCGTCAGCAGCAGGTGGAAGGGGTTCATCGACGAGGAA
TGCGATGGAGTACGTACTCGGACACTTTTCCTCCTCATGTAATTTCTCTGCTCCGCGTTTTAATGTTCGTTTATACTGCTGGAGAGTGACAAAATGGTGC
TGTTTTCCTTGACTCGACGGTACAGCAAGACGGCAGCAAAGTGATGAGAGCTTCCACCTTTGTCGACCTCGGTGCGTGTAGTCGCGTTTCAACACCTTGT
TGAATTGCTCACATGGATTGTTTGTTTTTGCATATCCAGTAGCACTGCCAGCGCGTTGCGCGTCCAGCAAGCCATACCTTCGCAAAATATGCTGCAAAAT
TCGCCAGCAGCGGTTTCCTTGCACATCGCTTGATCGCCGCCTGCTTGATTTGGTTGAATTCGGCTTGCCCTCGCGCAAAATCAATATCGAAGACGTGGCG
CATGGGGATGTCGCGTTGTAACGCAGGGAGCTTATTCGTGTGCTGGTGCACCTTAGCCACTACGTGATACCACCACATCAGGTGTGTATAGTCATTGTCC
ATGCCAAAGACCCTTTTGAACACTGTGTATATTGCTGCTTCAGCGTCTGCCATTACGAAATTCACCTTGAGCTGCAAGCTCATGACCTTGTGATATATAC
GACGCAGCGCGGTCAGCATTTCCACATAAACTACCTCTGTGCGCTGTGAGACGATAAAGAGCGCCAATAGGTGAAACGACCGAAGCCGATCTGAGATGCC
CACCACCGTACGACGAGTTGAGGTTAAACGCAGCGTCGACATAAAGCATAAAGGTGATGGGGTCGCGGGCGGCAGAATGCAACAGTCACGGTGAGGTTAA
ACCCAGCATGAAAGGGTCATCGTCAGTTCCTAGGCTGACATACGGCCTCCCGTCGATTTTCCCCCTCCACGCAAACGTGAAGGACATGTTCGCCCTCATC
CCCGGCATAGACAGCATCACGAACCTTGTCAACGATAAGATCGTGGTAATCGTTCAAGACTAGATTGCGCTTCTTATAGTTGCCGTCAAAAAAGCGCTGG
GCTGTAGACAGCTTTGGCAAACACTATGCATCCAGGTCGAAGCGTCTCAGCATGCCGTGGCGGATGTGAGAAGGGTTGAGACCTTGGGTAGCCAGCTCCC
GCGAAAAGGCTTTCATGGACTCAGTCAAATGTGGAGCCCGCGGAG