Description :
From Genome Similarity Track
Location :
Scaffold_129:23205- 24968
Transcript NameFunction/comments
Phyci_96531hypothetical protein

Sequence
1763 bases(100 bases per row)
CCGTGGTAAACCCGTAGAGCTCCGTGTCCAGCACGGCGTAGAGCATGCGCTTGAGTTCGGCGCGCGAGATCCCGAGAGGCAGGTCCAGCCGGTTGAAGCA
CGCGTAGCTGCGCACGAACTCGTCGGGCGCGCCCACAATGCCGCGGATCGTGAACAAGCACACCTTCCCGTCGTAACTGGTGAGTCCCTTGAAGCCCACC
AGCGGCACGCGCGAGCACCCGGTGGTGAACTGCAGCAGTCGGCGCCGGTACTCGTTGGGCATCTCGCGCACGATGTCCCAGAACCACACGAGCGTGGGCG
ACCGCGCGACGCTCTCGGCCACCGACGTGTTCTTCTCCCAGTCGCTTACGTCGATCTCCGGCGATCCGCACATGAGGTAGTCCAACTCTTCATAGTCGAA
CAGCATCAGCAATTGCTGCGGGATGACCTCGTAGATACCCTTGAGGAACACGTAGAGCTGGTCCGCCACGCTCCGCAGCAGCAGGTGCTCGAACTTGCGC
TCCAGGTACTCGTGCTTGTTGGCGTCGGTCACCTCGATGTTGCGCCCGTTCGGGATGAGGTCGACCGTCATGGTCCGGTCGCCGACGCGCTCCATCACGC
TGAAGTCCAGGTCCAGCGCCTCCACGCCGTCGTTCTCCAGCATCCACGCCATGCTCTTGTACACCTCGGGGTCAAAGTACTTCACGTCGTCCATGCACAG
GGGCGTGCCCAAAATGAGCTTCAGCAGCGGAACGCTCAAGTGGAAGTTGAGCACCGTGCCCTCCAACAGCGCGCGCCCGAGCAGCCGCCCCGCTCCGTAA
AAGTAAATTAGATGGTCCTCGCCATTGTCGTAGCGGGAGTTCGAGTTGAGGAAGAACGCGCGGTCCTCCCCCTGCGTGGGCTTGAACAGCCCCGCCTTCT
CCTCGGTCAGCAGCTCCGTGAGCATCATGAACCACTCGCGATGCAGCCCGCCGGCGTCCACGCCGTTCTCCTCGAGGAAGTTGATGCGCATGACGGACCG
AACGTATTTCTCCTCTATGCACCCGAGGTGCTCCATGGACTCCTCGAACATGAAGTCCCGATGGATGGACAGCTTCAGGAACTCCACCTCGGGCGGCACG
AGCAGCGACGCCGTGCTCTTGACGAAGTAGGCGTACTTGGTCGGGAAATCTTTGGCCGCGAGTTCCAGCGTCTCGCGGCGGCGCTCGGCGCCGTCCTGTG
TGTCGTCCTCGAACACCTCTCCGGTGGCGCGAGCCGCCGCATCCCACTTGGTGGCGGGGATGATATCCATATCAGCGATCTCGGCGAACACCTTGACCTT
GGCGGGCTCCACGACGGCCACCTCGCTCTGCGTGGCCACGGGCCCGGTCACCTGTCCGGGCATCTTGGCGCTCGCGTTCGGCTTGACGAAGCGGGCGACC
TTGCCCACGCGCGCGGGCGCCATGGGCCCGCTGCCGTCCTTCACGCGGAACCAGAACATGTTGCCCTCCACGTCCAGCTTGCGCGTCCACTCCTTGCGCC
TGCGGGCGCGCAGCTGGCGCTCCGTGAAGTGGCGCGGCAGCGCTGCGTCGTTCCTGCTCTCTtgctgctgctgctgctgctgcCGGTCTTTCCGGCGGCG
CTTCCTCCTGTTTCTGCCGCTGCCGTCAGCCGTCTCGCCCGTGTCCATGCGCTGCCCGCAGATGCAGCAGAAGAGCGCGTCCTTGAAGTTCTCGAACTCG
CACACGGCGCACGGCCGGAATCCCTTCTCGGCCTCGCGGGTGGCCGTGTCCAGGCGGTGGTCG