Description :
From Genome Similarity Track
Location :
Scaffold_447:232043- 234568
Transcript NameFunction/comments
Aphin_H310_09154chorismate mutase, putative

Sequence
2525 bases(100 bases per row)
GTTCCATGTAAAACCCGTACTCGCCGGCGGTCACACCGCGCTGCAGCGATTCCAGACACGTCATGTTGACGCCATGGGTCTGCATGAGCCGGGAAGTCAG
GGAATCGTGTCCTGTTCATCAAGATGTGTACCTTGAACACTTGGAGAGCCGACAGCAACGAACCGACCTCGTGCTTGACGTTGACGCAGAGACACGTCTT
GTCTCGGCCCGTCGGCGGCTGGGCCGCCCGTCCGACGACGAGAAAGCGGACCGACAGCGCCGGCGGGTGCTTGGAAATCGTCGACAGATTCAATGGCGGG
TCAAGAACGTGGAGGTCTGCGGCATTGGCGGCGTCGGCGGTCGTGATCGCGATCGCTCCGCGCAATCGTTGCGCGCTTCTCGCAGCTTCGTCGACGCTGG
CAACCTGGACAACCTTGGCGCTGCTCCACATGCGATCCACGATTAAACCGAACCCTGCTTCCGCCGACGACGGCATGTACACAACGGTCACGTCGGCCGG
CGCGACCGCGGCATACGACGTGGCGAGGACAAAAGGCCGTTCAAACACGGTCTCTGCAGTCACGACAAGGCCGCTCGCGATCAAGAGTAGTTGCGCGTCC
TTACTGATCCCTGTCTGTGCATCTTCAAACGCGACAAGGCCACACGCTGTTTTGTGTGCAACCACACTGGCAAACACATCGTTGAGCGACGCGACGGGAT
AAAAGTTGCGCTTCGCGACCGACGCGCCAAAGTGCGCGACTGCCGCCGAGTGGGCAAAGCTGCCAACAGGACCGACGAACGCCACGGACGGATGATGGAG
GCGCTGGAGCAAGTACGTCACTTGGACTTGTTTGGTCAGTGGCATGACAAAGTTCTATCGGCGTGCAAAGTGAGATTGGAGGTGTTAGGACGAGCAAGGC
CGACGGTGTTCTTACACGGTAGAGATCGGCAATCACTTGCGGATCGACTTTGCAGTGTTCGAAGGAAGTCGCGTCGTGCGTCGTGGAGCCGTCAATGTCT
TGGCCGTACGTCGACGCCTTGAACCGCACGCGCATCACGACTTTCTGCACGCATGCATCAACACGTCGTTGAAAGCGCAATGGCAAAAGAACGTACGTCT
TCGACCGCCAAGTTGGTCAGTGCGTCCATGATGCCTTCGGCGTCGTTGTTGAGAATGAGCTTGGTGTATCGCTCCGTCTCAGCCTGCAAAGCAAATGGTT
GTGGGCCTTGGATGGCAAGAGGCGTTGTAGCAGCATGTCGAGCTTACTTGAAATTTGGCTTCCGCGATGAACTTGCCAAAATGGATGCGCTTGCTCAATG
CTTGGAGCACCGCAACATCGGCGTTGGCCGAGGAGCCGTACTAGGACGCGTGAGGGTCCGAGGGTGGATATATCGAGAATGCCTACCGTCGTGTGATCAT
CGATGTCCTGTGTAATATGAGGCAGGAGCTTCTCGAGGTATACACTCATGATTTGATCGTTGATGTTGATGGTGTTGGGCATGAGGACAGTTTGGTAGTC
GAGAGGTGGCAGGATCGGGTCAGGCAGGAAGGACGGGAAAAATGCGTGCTCGTCCGGCGACGTGTACCGCCGGTTGAGCGCATGTAGTCGCTCGGTTTCA
CTCAGCATGAACTCAAGGAAGCTCCCTTCGAAGCTGTGATACTTGCCTTTGAAGCTCAGGAGGGACTCGGCCGCATCAGCCCGCTTGCGGTAGATTGCCG
TGTTGCGCGGGAATTGCGCGCGCTCAATGAGGGCAAAGATGATCGTTTCTTCTTGTCGGATAAGCACATTGCGGTAGTCGTCGAGGAGGACCTTCTTCGG
CGTCGCCATCGTGAGCCGCCGTGTGGCCAAACTGAAAATGTGGCTTCAAATTCGATGTGTTTGAAATTCAACGTTTGCGCAGTGCATCGGATGGATACTT
TCAGTAGAATTTCGGGTTTTGGGCTAAAATCTGCAGACTGGTCCTGATATTTCGTGGTAGTTGGGTAATTTCGGCCAAAACGAAAGGTATACGCGTTCAA
GGAGAATTCTCTTGGCAGAAGGTGGAGCCACCGTCGCAAGCCATGGTGGCATCCGCATGCATCCATTAAGGAACACCGGCGCCTCGGCATCGTCCAGCGT
TGCTACGCACCATTCAATTGTTGAACTCGTACTTGGAGAAGGAATACGCCCACATCGGAAGCAACTACAATTGTACACTCAATCCTTCCTCTTCAGTGGC
CCTCCTCTCCAAGTGCTGGTGCGAACTCCGCCCCATTGCGACGTTTCCATACATATCTATGGACACAAACGATGGCGTTGTCTGGTCTTGCGCAATGCAC
CTATTCTGTGACAAATTTTGACCAAATTTGATTTTATTGATATCATTTTACATATTGAATTGCGTTGTATTATATTCGTAATATTCAATATTTAGTACAT
TTACGATATGCCTAAGATAAGTACTTCTGCGGAACAAGCATCAAATGGGGTCGGACCAATGCAACCTAAATTGTAAAGGCGTTGTTTCCGAGACAATGAC
ACGCCGACTCAATTGAGGCCGTCAT