Description :
From Genome Similarity Track
Location :
contig_51:232012- 233543
Transcript NameFunction/comments
g8634.t1hypothetical protein

Sequence
1531 bases(100 bases per row)
CTGCCGCTTTTGAGCTGCGGCACTTCCGCCGACAGCTCGAGGTCGCGGAAGCGCACTTCAAGGCCAGGGATGGGGTGGCCCAAGGCGTTCTCAATGACCG
TCGACAGCGTCGAGTTCATGGTGAAGACGTCGTCTGCCATGAGTGCGTCGGCACTGGAGAGGTCGTCCTTCGTCAACTCACGGGGCTCAGGGAACATGCT
GTTGGTGCGGGGCAGGCGGTACGTCGACACCTTCGGCGCCAGGAGTCTGTCAGGGACAACGTCACCGACGCTTTGGTTGTCGGTGGCGTCGTCGGCGTCG
CTGTTGGTTTTGGTGGGCGGATGGTCTTCGCGTTCCTCCATTGCTGCGTTGGTGATCCGAGGCGAAATGGCGAGTGAGCTTTGGCAGGGTCTGGTCCAGT
TCCATCGACGCTAGACAACCGACAGACGCCGCCCTCGGAAGATTTGAAAGGTGCAGCAGCTCCGATGGAGATGCACGTTCAAGCACAGCGCCAGTGCTTC
GGCAGGGATCCGTTGGCGCCAAAGACGCTCGAGCTAATCGGCGTGAAGACGACTTTTGTTTGCTTTATGCGTTTGTATGCGGTGCCAGCGCGACATGGTG
AGACTTGTTGACGTGCCACCAGTGCACAATTGGGGCAGCGCCTATCGTTTCTCTGGATCTGCCTGCTACAGATGGTCCAGCGCAGAGGGACTCGAGCAAC
GTGGTTGTGATGCAGAATAGGAGACGCCTGGCAGTGTGTACCCGCAGTCTTCATCACGCTTTCTCACTAATGGCAAGCGGAACGGATATGCTGGTTCTCT
CCGGCTGCCAACTTCTTGTACGAGGAGTCTTGCATTGCTGAGGGCGGAACAGCGCGGGCGGGTTGTGTATTGTCGGAGGAAAGACATCAACATTCTCGAT
TACGCGTGGGGATGAAGTGTACAGCACTGCGCTCTATGCTTCATGTGCATTTATTCTTGTCGCGTTGAAGCACCAAGTGGAAGTTTGAGTTTCGCCAGAC
AAGGAAAGTGAGGAAGACGTCCAACGCACGAACGCTCGAAGTACATTATGATCCACCAAACACTAAACAACAACATACGCCTACCACTTGAAGTCGAACG
TGAGGCACGAGCGCAGACTCGGGAGGGCATTCACCTGGGCACGGAGCTCTCGACTGGTCGCCGTTGCCCCGCCCCACAGCCCCGCAGCTTGTTCCGCGGC
CAGCATGGAGCTGTCGAGCACCTCGGCCTCTCGTAACACCCGTTCTTCCGTGAGTAGCTCCAAGTATCGCTGGTGGACCGACACTTTCGCCTCGTCCTGC
GATTGCTCCGGCACGAGGATGGACGTGCGTTTGGCCAGCAATTTGCGGACTTGGATCTCCAGTTCGATCCACTCAGCTTCGTCCTGTGCACGCTTGGTCT
TCTGGCGACTGCGGTAGCCCTTCTCATAGCCGCGTTGCTTGTCCTTCCGTCGCTGGCCACGACCTGAAGGGTCGAGAACCTGCCGACGGGCTTGACGTGC
TGGTTTGGCGGTTTGCTTGCTCTTGACGGGG