Description :
From Genome Similarity Track
Location :
Scaffold_1262:2320- 6799
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1262-snap-gene-0.23'5'-cyclic nucleotide phosphodiesterase
Pytul_var.sporangiiferummaker-pug3_contig_1262-snap-gene-0.33'5'-cyclic nucleotide phosphodiesterase
Pytul_var.sporangiiferummaker-pug3_contig_1262-snap-gene-0.4Protein phosphatase 2C

Sequence
4479 bases(100 bases per row)
GTCGGCATCTCGCTGCACAAGTCGAGTCTCCACCACCAGGTCAAGACGTCGCAGAAGCTCATTGAGGCGCGTCTGAGGCTCACAACATGNNNNNNNNNNC
TCTGAGAGCTCCAGCATCGAGGAGTTCGTGGACCTGGTCATGGAGATCGGCAAGGACATCATGGAGTGCGATCGCTTTGGGTTCCTGCTCATCGACCATT
TCAAGAAGGAGCTCTGGATCACGCCGCGCGTTGGTGGCGGCGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGAACCGCGGAATCTCGGGC
CTCGTCGCGACAACAGGGCAGACTGTGTGCGTCCGCGACGCGTACAAGCACGAGCTTTTTGACCCGAGCGTCGATCTCAAGACCGGGTACCGCACGACGA
GCGTNNNNNNNNNNNTTCGAGGACCACTCGATCTCGAACCCAAAGTGCGTCGCCGTCGCCATGTGCATCAACAAGCAGGAAGGCTCGCACGTCGTCGCGT
TCACGAAGCTCGACCGCGACGTCATGGACAAGTACAGTCGCGAGGTGCAATTCGCGCTTGGACGGCTCTCGCTCGACATCTCGTACTACAAGGTGGTCTC
GGATTGCATCGCTGTATCTAACACATGGAGTAGTAGCCTCGGTGGTGGCACTGCTGGTAGCAGTGGCGCCGTACTGAACCCGGGACTGCGTCGCTTGTCG
TCGGTGCTGCGCATCGACCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGACATCATCTCGTCCATCGTGCACCGCTACTGCAACTCAATCCCCA
AGCAGAAGCCATCTGACAATAGGGCTAGTGGCTGCACTGGNNNNNNNNNNNNNNNNGCATCCGTGATCCCGGCGCTGATACGCAAAAAGCAGGAAGACGA
CGAGGTGCCGTTCCCGCGCGAGATCGTGTTTGCGCGCGGTGCCGATGAGCCGCTCGAGCAGTGGGACATGGACACGCTGTCGCTCACCAGCAGCGACATT
GGCATGCTTAGCAGCGTCGTATTCCGCGCCTATGGCTTCTTCGAGGCATTTCGGATCTCGGGCGAAAAGTTTGCGGCGTTCACGACCAATGTCGCCAACT
ACTACCGCGCGGGTAACCCGTTCCACAACTTCCAGCACGCGTTCCAGGTGACGCTCGCGATGCATACGATGCTGCGCGCCGAGTGCCGCAAGTTCTTCAG
CGGCGTCGAAATCTTTGCGATGCTCATCGCGGCGCTCTGTCACGACATCGACCACCCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCA
AGACGCTGAGCCCCATGGCGCTGACGCACAACGACGACGCCGTGCTCGAGCGCCACCACTGCCGCGTCACGTTCATCATTCTGAACCACAAGTCCGCCAA
GATCCTGCAGCACCTCGACGAAGCGCGGTACAAGCGCGTGCGGCNNNNNNNNNNCGACGGACATGGCCAAGCACTTTGAGAAGTGCAAGGCGCTCGAGTC
GCTCTCGAGACGCCAGCTGAACGAGAAGCGGCAGCTTCTGATGGGAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTTC
TACATGCAGAACCTCGAGCTTCGGAAGACGCGGCTCATCGTGCAGCTCAACTACATCAAGTACGTCGTGCGTCCAATTTGGCTCCCGCTCACGTCGCTGT
GCCACCATCTGCGGGTAAGAGTCATGCTTGCCTTTGGCCCCCATATCACCTTGACTGGGACTTTTATGACCATGTGACTTTGTTGCGCAGTTTTACACGG
ACTCGCTCGAGTTGAACTTCGATCTCTACCGCCAGCAACTGGATGAAGAGGGCGCGTAGTCGGCGGCAGTGACAGCAGTAAGCATTGAGACGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGACTCCAGGCACGTTTCACCCCATGCACGCTGGCTCGTCCAAGCTGCTTGTGACCTCGGACGAGAGAG
CCCATCACGCGCGTTAAAGCCCTAGTGTGCACTGCTTCAATTTCAAGCTGGTGCGGTGCTGATACACACTTAAATACATGCAATAATACACACTTGGAGC
AATTCCGAAATCCAAGATCGAAGCGAGAAGGAAAACACACTGGATGTGTCTTTATTGCTCTGTGCCATGCATTGGGTCAAAAGAAGAGCACGATGATGGT
CGTGTCGTCATGAAGTGGTCGACGATCGTTGCCTGGTGGTAACTTGAGGAGCTCCTCGTGCGTGAGGTTGGCTCTCACTGCGGCGTTCTGGAACGTGCGG
TCCACAAGCGCGCGAGCGACGGAATCGTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACTTGCGCACGCACCACCTCGACGG
CTTTGTCGCTGCTCACAAAGTCCCAGAGCCCGTCGCTGCCGAGAATAACAAATTTGTCGTCGCTCTTAATCGGAGTGCTTGTAATCTCCGGCACCACCGT
AATGTACGGCGGAGAGAACGGTTTGGGGAAATGGTGGNNNNNNNNNNNNNNNGTACTTGAGCGGGAAATCGCCAAACGCCCGCGTTGGTTGCAGCGCGTT
CTTCACGTAACACGAGTTGGGTGTGCGGCACACGAATGGCTCAGATTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTGCTCGAACGCGGCCATCGCGTTCTGGCCCTTACTGAGTGGCACAGCGAGCAGCTTTTCGTCGTCGCTATGATTGGTGCGGCCCAGTACCGCACGACT
ATCGCCAGCTAAACGCACACATTAATACGACAACGGTCAGCAGCTGCCAACGGCTCGCATCATAAAGAGAGTGCATCCTTACCATTGGCGACGTGCAGCG
TGCTCTCGTGAACCAGCGCGACCAGTGCGCACGAGCCGCAACGCGCGACGGTACCAGAGCCAGCGTGGAATGCGGGCGCGATTTGCACCATGAACTCGCG
GTCCGTGCGGCCGAACGCGCGTTGGATCGCCAATGCGACTTCGCTGGGCGATGCATGCTGCTGTTCTGTTGGGCGCAGCTCCTTTTCGATGTTACCGATC
AGCGTCTTGCGGACAAACTCGGCCACTTGCCAGCCACCTGTGTTGCAAATGTACAAGAAAACCATTGGACTTAGGTCGCTGAACTGTTAGCCAGCTAGCA
TTCACAATTGACGCACCATGCCCATCGAAAACGGCAGCGCAGGCATCTCCGTTGGCCGTTGACTGAATGTTAAAGCGATCTTCACTTGGAGCGTTGGATT
TGTACGTCGCGCAGCTGAAACGCTTGGCGAGTAGGTGCTCGAGTTTCGCAAAGCGCTCGCTCTCGAGTTACAAAATTGGCGAAGACGAGCCCTTGGCAAA
CTCTGCACCTCCACCGCTGACGGCCGGCGTGCGTTGCACGTTGCGCATTGCATTGCGTGGGAGTGATACGAGCCGCGTCTGATCCACTGCCGCCCATGGC
AAGCGCAAGGACTGCAAGTCCGATGCCACTGGCCACAAGCGAGCTGTGCGTCTGAGACGTGACACCCTTGGTGGTTTAACATGCACACAAATGCACTCAC
GTCAGTCTACTGCAAAGGGAATCCAATCTCGCCAATATGTACCGTGTACTACATGTCCTTACCTGCACGTTCACAGTATACAACGTGCGTGTGAAGAACT
GGTGGCGCCGGTACATGACTGAAAAGAGCTCTTCGAGTGACGGAGGTAGCAATGACACGCTGGTGGTGGGCTAGCTGCGAATTGCAAAGTGAATAAGAAT
GGGAGGTCTCATGCAACATCGCCGCGTCGCCTGCTGCAAAGCGCGTGCTGTGCTTTGCTTACATTCGCGTCTTGTGAGCTCCGCATGGATGAGTGCTGAG
ACCAGGAATGCTGGTTGACGACCAGCACTCTGTGTAAAAGTCAGAACGAGAATGCCGGTAGCATACCTTTTTTGACCAATGAGTCGTTTGAAATGGATCA
AGATAGCCAATGAACACACTCGTAGACAGAAGTGACCAGCATTTCGAGAACCGCCTCTTTGAAGATGAATGGATACAGTCCAATAGATGATGAAGTGCGT
TGCAGAACCCGCTCATGAATAGCGCCGAAACAGAGCTCTTCGGTTGAAGAAGCGCGATCTTCAAGCGATCTCCAGCGATTTGCATCGGGCACACAGCACG
TGGCCGCAGACAACAGACAGATTATGCCAAGGAACTTTGAAGAAATGGAACAGAGCAACTCCAATTACTTGTCACACAGCAACCTTTCGTGTTGCTGCTT
GTGCATTGTGCTGCGTCCTCATGTTAATTGTCTACAACACTGCTGCTTCCATCCAATCCACAGGTCTGCATCGTCTGTT