Description :
From Genome Similarity Track
Location :
Scaffold_818:232- 3235
Sequence
3003 bases(100 bases per row)
CTGTCCTGGGTCGAAGCTCGTATATTGACGACATCGCCCATGGTGCGCCTACTTGGGAGCGGATGTGCCAGGATCTGAACGCGCTGCTCTTCCGACTACG
TTACTGGAATATCTCTGTGAGTCTTCCCAAGAGTGAATTCGGGAAGTTGTCCATTCCGTACCTCTCCCATAAGATTATTGCTGAGGGTATCCGGGCGACC
CCTAAAGTCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGACGACACTGAAAGACGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTG
AAGATCTACCCATGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAGGTGAAATTCAGGAGAGACCTGTCGAGAGCCCAGGAAGCCTTTGAAATCCT
GAAGCGCAAGATTGTTTCGACTCCGTTACTCAGACATCCTGATCGTTCAATGCCCTACGTGATTATTCCCCACGCAAACCCGTGGGCAGCATCCGCTGTG
TTGGGCCAGGAGTACGACGGGATTGTGCATCCGGTTCGATTCACCGGACGCGTCCTGAATGACGCTGAGCTGCGGTATCACATTGCGGAGAAGGAGGTGA
TCGCTATCCTGAGAGTCCTGGAGGTGTTTCGCACTCTGGTTGAAGGCAGCCCTAAGATCGTTGTCTACACGCGATACTCTGTGTTGAAGTGGTTGCTGAC
TTTGCAGTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCACTGGAACCTGGAGATACGCATAGTTCAACGGGATAAAGACGGCTTGGCT
GCAATTCTGGGTGCGGGTATTACCCCCAGAGAACACTTGGATGATATCGCTGAAAACTTGATCCCAGCCAAGGGGCGCGTCAAACCTCCAGTGCCTATCA
GTATGGAAATGCTGGAAGCGGATTATGAGGGGTGTATTCTGAGTTTCGATGCCGCCGCTAAGACCTCCACGCGACAAGGGAGCTGCGGCTACATTCTGTG
GCATGTCCCCGGTTGGGAAATCCTGGATGCCCAGGGATTCATCCTGGAGAACGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGAAGGGCCTCACT
CAGGCGATCGAGCGTGGAATTCAGGATATCGTTGGGGTTGGGGACTCCAGGATTGCCATCCATTAAGCCCAGGGTCTCATCAACTGCAATCAGCCAAATC
TCCAGAGGAAGCTGGCCGAGTATGAAGTGCTGAAGACGCAGTTCAAGTCTGTGCGGCTGGTGCATGTCAAGCGAAAATTCAACCAGGCTGCAGACTACCT
GACGTCTAAGCCCCTCGCGCTTGGTGAATTCTGGAAGGTGGAGGATGCTGAAGAACGAACACATCTGCAGTTGGTGTCCAAGATTCACGAGAAGTTGGTA
AAACCGAAGGTGTTATTGAACGTTGGAATTCAAGGGAGTGATTCTCAGGGTGTCGAAACTCTGGGTATCCCTGGACCTGAGTGCGCTCCGTTGCCTGCGG
CGGCTAAAGTGTTCGCAGTGATGACTCGGGCACAGACTCAGGAGATCGAAGCCCAAAGCGAACCCATGGGACCTTTGGAATACCAGGCTGAACGCTGGCG
ACGCATCAAAGTGCACCAGGACAAAGCTGATCACCTGCTGCGACTCAATGATTTCCTGAAGGGCGACACGACGAAGCTGTCGCACGCTCAAGCCTGTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCACACG
GTACTGTGTCTGCAATGCTGGGACCCAGGCCTTCAAGTATCCAGGAGCGCACCGCGTACGAGTGGCCCAGGAAGCTACAGCGTGACTACAGTTATGCACA
AGCTTGCGCTGAGAATCTCCAGAAGAAGGCCAAGCGGGCGCGCTCTGCCGAACAAACCAGGAAGTGGTGAGAGCTGTCCGAACGACTGAAGGCAGGATTC
GCAGTCGGTGATGCTGGGTGGCTGTGTGGCTGTATATACCGAAGGTGCAGCCCGGGCTGAGCCGCAAACTGGCTCACATGTGGCATGGTACCTTCAGAAT
CCAGGAAATCCATGACAACTTCCGCGTGAAACTCAGGGTCGAGAACACAGGGTATCGCGTGAACCCCTGGGTACACGTGAGCTGTTTGAAACCCAGAGCA
CTATTCCCGAAGCGACCCACTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTGCTGCCTGAAGACAATTGGGAGCCCGACACTGCGA
ACGACGAGTACGAAGTTGAGCGAATCCTGGATTTGCGCTGGACTAAGCGGACCCGGACAGCGAGACGTATTCGCGAGTACCTTGTAAAGTGGAAGGGGTA
CGATGAGGCCGAGTGGCTGCCTGTGTCGAAGCTCAACTGTGGCGCCCTGCTCTACGAGTTCAATCAAGGCGCAAGAGCGCGAGCCCGTTTCCAGGCCATG
CAG