Description :
From Genome Similarity Track
Location :
Scaffold_3698:232- 1431
Transcript NameFunction/comments
Phypl_g15984hypothetical protein

Sequence
1199 bases(100 bases per row)
TGTTGAGTACGCGGAGGGCGGTCCGCAAAGATCCTGAGTCATCGAAGTCGCGAGTCCTACTCGCGACGTGTCCTCGATCACCCGCCTTCCAGGTCTCTCC
TGGAAGCatttcctgcgcgacctccAGGCTGGCGACATCGAACAGGTCTGCTTGATCACCGACGCAGATGCGACTGTCCACGCGGTCAATGCAggctcgc
cgtcgcgtccCAAGAGCGCTTAACCAAAATCGGCCCGCGAAGAACGCTTCGCGGCGCAGTCGTGGGAGGCCCTGCGTGAGTCTGGAAACCCAGTCTACGA
CACCGCCCGCGAGTACGCGGACGTCTTCCCGGACAAGATCCTCGCAGAGCTTCCCGCCGACCGAGGTGTTCGACACGATATCGATCTCGCCCCTGGTACG
AAGTACTGCGTGGCGCGGCAGTGGCCACTGCCGCGAGACCAAGTCAAGGCCATATATGACTTCTTCGAGGGTCGCCGCAAGGCGGGCCACGTACGCGAGA
GTATCTCGCCGCACACGAATCCGACCTTCTGTGTGNAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAAGGCCTGAAGAACGCTCCTGCTACCTTCA
ATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCGTGGCTTCGCGCCTAGTTATTTCGACGACATATTCGTACACAGCCGCGCTGAGGACGAGCTCAGCGC
AGTAGAAGTCCACTTGAAGCACTTGAGGCAAGTCTTTCAAGTGATGAGGGAGAACAAGTTGTACGCAAACCTGAAGAAGTGTGTCTTCTGCGCACCGGAG
ATTCCGGTGTTGGGCTGTTACGTGAGCAAGGATGGAGTACGCGCTGATCCTGGAAATATATCGTCTATTTGTTCTTGGCCAGCCCCTAAGAGCCCGACTG
AGTTGCGTCAGTGGCTGGGCTTGGCTAACTACCTGCACAAGTACACGAAAGATTATGCCGGATCGATGCTGAAAGACTACGTCGTCTGATATTTTCTCTT
CTGTGGCCATATCTGCACCATATCGCTCCGAGTTCACAGCATTCTCAACAGCATGTAACGCTTCAGTGTCACTTACAATAACATCCTCTTCGATAGCACG
TTCTAACGCAGCCAAGTTTTCCAATTGATCACGCGGGTCATCTATCTCAATACCCTCTTTCCGGAAGCAACTGTGCGTTTCCTTCAAAACAGCTAGCCA