Description :
From Genome Similarity Track
Location :
Scaffold_818:232- 1350
Sequence
1118 bases(100 bases per row)
CTGTCCTGGGTCGAAGCTCGTATATTGACGACATCGCCCATGGTGCGCCTACTTGGGAGCGGATGTGCCAGGATCTGAACGCGCTGCTCTTCCGACTACG
TTACTGGAATATCTCTGTGAGTCTTCCCAAGAGTGAATTCGGGAAGTTGTCCATTCCGTACCTCTCCCATAAGATTATTGCTGAGGGTATCCGGGCGACC
CCTAAAGTCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGACGACACTGAAAGACGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTG
AAGATCTACCCATGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAGGTGAAATTCAGGAGAGACCTGTCGAGAGCCCAGGAAGCCTTTGAAATCCT
GAAGCGCAAGATTGTTTCGACTCCGTTACTCAGACATCCTGATCGTTCAATGCCCTACGTGATTATTCCCCACGCAAACCCGTGGGCAGCATCCGCTGTG
TTGGGCCAGGAGTACGACGGGATTGTGCATCCGGTTCGATTCACCGGACGCGTCCTGAATGACGCTGAGCTGCGGTATCACATTGCGGAGAAGGAGGTGA
TCGCTATCCTGAGAGTCCTGGAGGTGTTTCGCACTCTGGTTGAAGGCAGCCCTAAGATCGTTGTCTACACGCGATACTCTGTGTTGAAGTGGTTGCTGAC
TTTGCAGTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCACTGGAACCTGGAGATACGCATAGTTCAACGGGATAAAGACGGCTTGGCT
GCAATTCTGGGTGCGGGTATTACCCCCAGAGAACACTTGGATGATATCGCTGAAAACTTGATCCCAGCCAAGGGGCGCGTCAAACCTCCAGTGCCTATCA
GTATGGAAATGCTGGAAGCGGATTATGAGGGGTGTATTCTGAGTTTCGATGCCGCCGCTAAGACCTCCACGCGACAAGGGAGCTGCGGCTACATTCTGTG
GCATGTCCCCGGTTGGGAAATCCTGGATGCCCAGGGATTCATCCTGGAGAACGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGAAGGGCCTCACT
CAGGCGATCGAGCGTGGA