Description :
From Genome Similarity Track
Location :
contig_30:231968- 284429
Transcript NameFunction/comments
g6558.t1hypothetical protein
g6559.t1hypothetical protein
g6560.t1XP_009538867.1 hypothetical protein PHYSODRAFT_533148, partial [Phytophthora sojae
g6561.t1XP_009538864.1 hypothetical protein PHYSODRAFT_533258 [Phytophthora sojae
g6562.t1OWZ14622.1 hypothetical protein PHMEG_00011874 [Phytophthora megakarya
g6563.t1XP_009538863.1 hypothetical protein PHYSODRAFT_532690 [Phytophthora sojae
g6564.t1hypothetical protein
g6565.t1RAW38030.1 hypothetical protein PC110_g5736 [Phytophthora cactorum
g6566.t1XP_009538858.1 hypothetical protein PHYSODRAFT_353200 [Phytophthora sojae
g6567.t1KUF80240.1 WD repeat-containing protein 16 [Phytophthora nicotianae
g6568.t1hypothetical protein
g6569.t1hypothetical protein
g6570.t1ETP36559.1 hypothetical protein F442_15538 [Phytophthora parasitica P10297
g6571.t1POM58883.1 Traub family protein [Phytophthora palmivora var. palmivora
g6572.t1RAW42912.1 hypothetical protein PC110_g976 [Phytophthora cactorum
g6573.t1hypothetical protein

Sequence
52461 bases(100 bases per row)
ACTCTTACATCCTTATCAACACCTAACTTACATTTAGAATCGCATCAAGCTGTAGACTGCCACCTTGAGATGACTGAGGGACCCACAACAACAATGAACC
ACCTCCTGTGCCAGGAAGCCCCAAAAAACCCGGACGCCACCGATCCAGATACAACGTTTTACCTCCCAAAGCCGTAACATTCGAGACCCAGGTTGCAGTT
TCACCGGCTCGGACATCAACTTCATCGATTTTGTTGCCGCCAGATATGATGTTGACAGTCACGTCCTTCGTATCTTCACTCTTGAAGTTAATATTCACAC
TTCCATCGCCAACTTTCGTCCACGTGCCGTCGCTGTTGTTGAAAGCACCCTGAACCATTTTCAGTGCTAGCGCTTTTTCCGCACTACCATCGTCGACCTC
GCCAATGAGCTGAGTAGGACCACATATTGGCTGGAAGTACTCGGAAAACGATCCAGCGACAGACCAATCGTCCCAAATCGCGTACATTCCAAGAGCCTTG
TCAGCGATTTTGAAAGCATACTCGCCAGCATGGAGAAAACTCCCGTTGCTGCTCGTTCCCGAACTGATGAGATCGTCCACAACACTCGCAAACGTTTTGC
GAAGAGTGTCACGTGTGGCGTACGCCGTCTTCTCGTCCGATTCCTCGATCAGCTCCCCCATGCAGTTATTAGTTGCGATAGGAATGTCGTTGAGCACCAA
GTTCGACTTGCTCATAGCTACACGAATATCATCTTCGGACATTTCCGGATTCTGTTTTCGATATTCAGCCACAGTCATCCATGTGCGATCCAGCAAGCGC
TTCATGTCGTAACCACACGTGGAGTTGGATTCCATCGCTGATTCCAAAGAGGTAATGTCACTTTTGCTCAGCGAGCTGAGGGTCTCGCCTAGCGTGATAT
TCTTCATGAACGATGTGAACTTGCCCCAACTGGAGATGATGGTGGCGCCGTTAGCTATCACTTCTTTCAGAACGTACTCAGCAGTCATCATCACACTGTC
GACGAACTTGACGTCATCCGACACGGAGTTTCCAATGCAATAGGCGACCGCGATTGGGATATCAATAACGACATTGTCCGTTTGGTACAACATCGTCAAT
ATCTTGTCTTGCGAGGTTTGAGGGTCTGAGACTTGGAGAGCACGAACATATTTCGCCAAAGACTTTATCAAACCCATCGTGTACTTGGCGCACTTAATTG
CGACTTGCACAGCCCTTGCCAACACCGCGAACTTGCCGAACACATCGTACGAAATGAGAGATAGCGTTGTCTGAGCTAAGGCCGTAACCTTGGTGACGAT
TTCGAGCGCGCAGTCGTCGTTCTGTCGGATGCATTCCATGCCGCATTCCACAGGGTACGCGTATGGACACTGAGCCCAACAAGTTCCTAGCTTGCCTTCG
AATCCAAGCGGGCAAGTCTTCGCAATGTGGGCTTCTCGGTAGCACGCGTTGGCGATTGAAGTATCGAGAGCAGAACCGACCCAATTCGTGTAGGTAGACT
TGATCGTGCTGGTTGCTTTGATCACGCCGCCCATGGTGAGTGCAGCGTTCATGGTCCTGGAGATCAGTTCTGACTCTGCAGCTGCGTCGCTGACCCTGTC
CGTAGCCTCGTCCTGTGTGGAATCCCTGTCACTGCGGTCAGACTTACTCGAAAGCGCAGTGTGTGCGATGCTATCTATCGAGTCGCTGTCCTCACTGTCG
GTCGAATCGCTGTCTTCACTGTCCAATGAATCAAAAGAGTCATCGTCGCTCCTTGATAGCCCAAACGAAGACACAGTCGCTTCCGGCGTCCCAATCGTTG
CTAAGGTGTCCGACGCGGCCACAGTAACGAGAGGTGTCGGCGTTGGTGCTGAGTCAACAACTTTACTGAACGCGAATGCCTTTGCCGGAACCTGTGTGGA
CTCGCCCCTGATTGCTGCGACGGCGACGAACATCACCATTGCCCTGAGTATCATGTTTGGGCACTCACGCGCGCCAAAGAGATCGCCGGGCGGCGTTTGT
CTCGAACACAGCAAAATGGGAAGTGAGCTGTTCGATTAGCGAGCCCGCTCTTCGAGCCGTGTCTCTTTTACGGGCACCGGCCGCGAGAATCGTGTTCATC
TCTGATGAAAGTCCTTCGCTGTGGGGGAATCACTATGGCTGTACGATTCCTACCGCAGGAAACCCTAGCTTTAAAAAAGTCAAATCTTCAAAATAGTCGC
AGGGCAGATCATCGGAAACCGGTTTGACACGGCGTTCAGTATATTGAACACGGCTTTCCCGCGCAGCCATCTGGCCGACTCAAAATATCGCCGAGTCGTA
CGAGAGGGCTTGTCTCCGCCATTCGCTTGGTCGGATCGAATCTCCACTCTGCGAGAGAAACAGCATCTTGTGGCGTCGGGATAGGGACAAGGATAGGATG
GAAATTCAGCCTGTTCTCAACAATCGAGAGGCACCGCCCCGTGTTGCACAGTAAATTTTACGGACTGCATTCTGCAGCTCGAGACAACGCATGAACAGTG
GTGATGTGAGTTGCTCAAGATTTTTGATAGGTGTGCGTCAAAGTCATTTGACTAATCAGCCTGAGTCAGCCAAGTGTGGAATGGGTCTTTACGGAGCATC
ATTTGTGCTGGAATCACTCCGCTGGCGGCTCTCTGAGTCAGCTCAGGCAAATTTAATTTGTATCTTTGGCTGGTGACTCCGTCTTAGTAAAAATTGAGGC
TCTACAGCCCTATAAACAAAACTTAGCTTACATTGAGTATCACGTTGAGCCGCAACATGCCGCCTTGGGTAGACCGAGGGACCCAAAGCAATAATGAGCC
GCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCGCAGTCACGTTCGACGTCCACGTCACGGTC
TCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGTATCGACGCTCTTGAACGTGATGGTTACAG
TGCCGTCTCCAACCCTCGTCCACATTCCGTCACTGCTGTTAAAAGCGCCTTGAACGATCTTCATGCCGAGGGCTTTCATCGCGGTACCGTCGTCAATTTC
ACCGATGAGCTCTGTAGGACCGCAAATCGGCTGGAAATACTCGGAAACAACTGTGGATACGTACCACGGATCCCAAATTGCGTAGAATCCCATGGCTCTA
TCTGCAACTTTGAAAGCGTACTTCTCGGCAGTCAGAAATGTGCCATTGTTGCTCGTTCCCGAGCTGATGAGATCGTCCACAACACTCGCAAATGTTTTGC
GAAGCGTGTCACGTGTTGCGTAGGCGGTTGCCTCGTCGGATTCTGCGATCAGCTCGCCCATGCAGTTGTTTGTCGCAATGGGGATATCGTTCAGCACAAG
GTTCGACTGGCTCATGATCGCTCGAATGTCGTCTTCGGAGATATCCGGGTTTCGTCTGCGCAGCTCTGCCACGGTCATCCATGTGCGATCCAGCAAGCGC
GTCATGTCGTATCCGCAAGTTGAATTCGACTCCAGCGCCGTTTTCATATTCGTAATGTCGGTCTGCTCGAGAGAAGCAATCGAATCTCCAAAGGTAATAT
TCTTCATGAAGGCCGCGAATTTGTCCCAACTTGAAACGATGGCCGCTCCATTGTATAGGACTTCCCTCAAAGCGTACTCTGCAGTCATCAATACACTATC
TGCAAACTTGACATTATCGGATGCCTTTTTCCCGATGCAATAGGAAATTGCCACAGGGATGTCGATAATGACATTGTCAATCTGATAAAGAATCGCGAGG
ATCTTGTCTTGCGAGGCTTGCGGGTCATGAACTTTGATATAGCGAATGTACTTGACTACGACTTCGTGAGGCTGATCATGTACTTGGTGCACTTGATAGC
GAGTTGAATCTTCTTTGGCCACTTGGTCATGTCGCCGTACATTCCCCATGAAGCCAGCGACAGCGCCGTTTGAACTACGACTGCAATCTTACCGAAAATT
GCGAGCCCACAGTCGTCGTTCTGCCGGATGCATTCCATACCGCACTCGATAGGGTACGAGTACGGGCACTGCGCCCAGCACGTCCCCAGTTTGCTCTCGA
AACCGAGCGGACACGTCTTGGCGATGCGAGCTTTGCGCCAACAAGCAGAAGAAGACAACGTGTCGAATGCAGAGCCAACCCAGTTGACATAAGTAGGTTC
AATCGTGCTAGTGGCATTCAGCACACTACCAAGCTTGAACGCCGCCATCCATGCTGCGGTTGGCGCTGCGGCGGACTCCATCTGTGAAGATGCAGTGTCG
TCGCTTTCCGCATCGTCACTGTCTTCAAAACTGTCGGCATCTCGATCGTAGGCTCTAGCTTCCAGCTTGACGGACAGCGCTGTCTGGCGAGACTGTCCGT
GAAGTCTTCGACGCTGTCTTTTAAGTCATCTTCAGTCAGGTTGAATGAATTCACAGCCGTGGCTTTCTCCGTCGCCGACTCATGATCTCCAGCGACCACC
GTAGCTAGGGACATCGGCATCGATGGATCGCGCTCGTCAAACGTGTATGCCTCGAGCAAGCGAATCCCGTTGAGCATCACTGAGAAGACGGCGAGAAACA
ACGCAATCCTGGCCATGGCGTCTAAGCAAGAAACGTTCTTGAGCGAGTATGGCAAAATGAGGACTGAGATGGCAGTGAGGAACGCTTCACTGACGCATCG
GAGTTACGAGTCCCAGGTTCTTGAGGCTCTCCTACTTGGCGGTCGTTCACGGATACCTTTGTCTGCCGCCGGATTAACGACCGCAATGTTCAAAGCCAAG
GCGATCTGGCCATCGAGAGGCGCTGCTTCCAATCCAGAGTATTATTATTCGTCGGTAGGATTACCAAATGTCGTGCTTTTGAAGGGTGCGTGTGTCCTGC
GCCAGTCACTTGTCGGTCACCGTTTGAGACGTACAACCACCAGGATACGAACAGGGATTAGCACGCCCGTGTTGCTCAAACATGTCGATTAAATTCAACT
GAGACCACCGCAAAACGGCAAGATACAGTTGAAGCTAGGGATGTGACGCGAAGGTACGCACTCTGGAATGTGACACGAAGGTGCATTTGTTTGAATGTGA
CACGAAGGTGCCGAGCCACAAGCCACACAATATCCGCTACATAGAGGAAGCTCGCGATCGACATGGTGCTCCACGTGCTCGGCGCTCTCCGTGCGGCGGG
GCGACGCGCCGCTACCGCCAGGTTCTTGGCCACTCGCAGCATATTGCAGAGCGCCACATTCGGCACGCAGGCCAGTGGTGCGTGACAGTTAACAACGCGA
GATTTTTTGGCACTTGCCTTTTCGCTGACATCACTATTTGTTTCTTATTTGCTGCCAACTATATATTTAGTGTACACGTGGGGAAATGGCACGCTGGGCC
AATTAGGTCATGGTGAGGTGGTCAAGTCGGGCATCCGCAGTGCGTACGAGGAGCTGACGCCCAAGCTGCTGGAAGCGTTCGAGGGCAAGGCCATTACTCA
CGTGGAGTTCGGAGCTAGCCATAGTGCTGCCAGTATGTCAATTTGTGGTTTTCTTATTTGTTTGTTTGTTTTGGTGGTGCTGATCTAGTATTTGTGCCTT
TGTGTGCTTGTACTAGTTGACGAGGATGGCAAGCTGTTCGTGTGGGGATCTAACGAGTACAGTAAGCTAGGACTGGGAGAAACCAGCGAGATGGAGACGC
TCCCGCGTGAGGTGGAGGCTCTCAAGGGCATCAAAATCGTGGACGTCTCGTGCGGCGATTATTTTACGGCTGCAGTGGACGCGGACGGCAAAATGTACTC
GTGGGGCTGGGGAGGCTCCACCATGAAGGGTGCAGGTGGTCTCGGCCACGCTGGCGGCAAGGACGAGCCCACGCCGCGTCTGCTGACGACACTGGTGGAC
CAAGGAGTGCCCATTTCCACGGTGGAGTGCGGTGAATTCCACACGGTGGCGCTCACCAAGGATGGCGAGATCTGGGCCTGGGGTAACGGCGAGTACGGAC
GTCTGGGCAACGGCGAGTCCGACACGTGCGAGGTACCAGAGCCTGTTGAGTTCTTCTCTAAGGACAACGTGCTTTCTATCGCTGCTGGTCGTGACTTCTC
CTTCGCGCTGACAGAGAAGGGCGAGCTGTACAGCTGGGGAGGCAACAGTCGTAAGTTGAAGCTATGGGGTTGGCGATCTTTGTGAGTGATGCTCAATTGC
GTGTTGTGATGCTACCACAGAGAACCAGCTGGGTATTGGCGGTGGTCTGGCCATGGATGTGTACAACATTGAGTCGATTCCGGTGCTGGTTGAGGCGTTC
AACGGTCTGTCTGTAAAGCAGATCGCTGCCGGCTACGACCACGCTGCCGCTGTGACGGAGGACGGACGTTTGTACATGTGGGGCGCTAAGATCTGGATCG
AGCCGCACGAGATGACGGCCGTGAACGAGCACAAGATGGTGCAGGTGGCCTGCGGGCGGCAATACACCGTGGCACTCACGGATGACGGCAAGGTCTTACG
TTTGGCAAGGGTAGCTCCAACTGCCTGGGCCACGGTGACCGCAAGAACCAGCTGCAGCCTCTGCAGATCGAGGCTCTGGCTGACGTTAACATCACCTCGT
ACGTAGCGGACCGTTTGCGGCGGTAAAGCGAATTGCAGAGCAGAAACTAACTGACCTCTATGCTGTGCAATGCAGGGTATCGTGCGGCGACTACCACATG
GGCGCCATCGCGACACCCCATGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAAGTTGGCCAGTCGTAAGGGACAATAAATCGCGCGCGGT
CAACCTGATGCTGTTTGCTTCACCTTGCTGTTTACCGAGGCTGGTTTGCTCGTTCGTGTAATCCAGGACTCCGCAAAGCGTCGCCGATCTTTCGAGTCCA
TTTTGCAGTCCTACCGTTGTTGATGATTCGCGTGGTGTTAATGTGCGCGGCAATTCTGCCTTGGCTTCTGCTGTTCTCCGGGCTGTCCCTGCCACCGAAC
GATGAGTCAAACTCAACTTGGCGGCAAAACGGCGGTGTGGCTGTGTCGTTGCTGAATGGAGTATACGCATTCGAGTGGCGACAGGTTCCGCGGTGGTGGA
AAGGAAAGCGTCAGCTCACTCTCACACTGGACACGTGGCCCGAGCCGGAGATCGACATGGACGAGTGTGTGGCTCGCTACCAAGACTCCAAGCGCGACGA
GGTCTGTGTCATCAGCCGGTAGACAACTATGAGAAGGGGAAGGAGGGGTCAACCGACGTATCAAATTAGTAAATCTATCGTTCTATACTGCCTTGCAGTC
TTCACTTGCCGTCACGCTTCCGCTTGAGGTTGTTACGGCTCTGCATGACAGCGGAACCGGTGCCGTCTGCCGCCACAACATCCGTGACAACGTACGGAGC
TTGGGCCGGTTCGTGAGCGGATAACATGATGCTGGCGAGTGGCATGCTGCTACGGACCAGGAGGTTGACACGCTTTAGTACTGACAGCGGCAACGGACTC
AGGACAAACAATCGACGCTTCTCGGCGTCCACGGCGCGGATGACCCCCACGCCCACACACGGTGCGTGCACTGGCTGCAGCACGATACGCGGGGGTCCTT
CTGTGTCTTGCTCGAACGGTTTGTAGTCAGGGTTGACGCAGAGACCCACGATGCAGGCGTTCAACGAGAACAGGAGCTGGCTCGGAGGCACAGAGGAGCT
GGCGAAGGAGATGTCGACCTGGTCGAATGGCACCGCGAAGGGTGGGAGTTGAGAATACGCGCGGTAGATGTTGCTGTCCACGCGGTTCTTCTCCGAGAGC
ACTTGCAGGTTCTGCAGCAGTGCGCGCGGGAGGTCGCAAGGAGTGCGGGCGAGGAAGTACGAGTGGAAGCGATACAGACGCATTTCCTTGGAGCTTCGTG
GGGGTTGAGTGACGCCAACGGGATCCCAGGGAGGAACTCCGTGAACGCGCCACCGACCGTCCGTGGGGACATCAAACTGTTTGTTTTTCGTCGCGGCAAC
CAACTGCACGACGTGATCGGGGTTCGTCTCCTGAATGACGTTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCATCCGTCCGTATTAATTACCAGCGGA
ACGCAAGCGCTTTTCCGGGGACTCGAGTCGGCTCCGCTTCCCCACTTGCTTCATACAGACGCAGCAAGCTCTTGACCGCCTTCATGTAGTACAGCGGGTC
GTTGCCCGGGTTGGCGTTTCCGCAGAAGAACGACCGGACCGGATTCTTCATGTGCGAGAATCCTGGACCAAGCAGCGGCGTCGTCAAGGCGTGCAGCGCT
ACAAGGCCCGACGGCGTGAGCTCACTCTGCCCCAGATCCGTGTCCAGGAAAGCGACCGTGTCAAACTTGGCAAGCAGCCGGTTCACCAGATACCTGCAAA
ACGTGGACTTGCCCACCCCCTTGCCGCCACAGACCACAATCTTCTGATACGCTGGAGTCGCTTCGTCCAGCAGACTCGACTGCAACCTGTCCGCAGTATC
CTGCCACGCCTCTGTGAAATGCAGCGTCCTGAACGAGTCCACCACGACCAGCTCAGCCAGAACACGCTCCGGCGACTTCCAGTCATGATGTAGCGGGTCC
GTGTTAGGAGGCGCCGCACTCGTACAGTCGAAGCCTGCAGTGATGTCGTTCAGTTCGTTCTGGTTGTGTTTGGCGACCATCATCTTGAAACCAGGCAGCA
CCGCCGCCGGTTTCTCGGGTCTCGCGTTCTCATAGAAACTCGAGATATTGCCGAATGTGACGGGGATGGCTCGCAGCACCAGCACAATGGGGAAATCGTC
CGCGAGCTGCATGGCCAGTCGGTCCGCCGCAATCTCCTCGTCCTCGCTCAGCGCTTCGGGTGGCAGGTTTGGCTCCATGGCCTGCAGTAAACTCACATTG
ACAGGTCCGAACGGCGCCTGCGTCTCCTCATTGCCCGAACGCCCCTCGATCACCAGCAGGTTGTTCCACTTGGGTGAATGCAGCGAAAAGTAGACGCCCA
ATGGCGGCCGGAAGCCCAGCACGTCCACGTTCCCCTGGAAGAGCCGGAAAAGCGTCATACCGGCGCAATTTACGCTCGAAAACCTCTGCATCCCCAGGGC
AACCACATTGCCCGAACGCACACAGAGCGCGCGGTACAGCGGTGAAGATGCCGACGCGCCGGCCCCAGGACCGTAATGCGAGATGCTCGTCATTGCGACT
GATGATTGGCCACGAGCGATATGTGCGATTCTCACACGTCACATGTCCTTAAACGGAGGGTTTAGCTGCGTGCTGCTTCAACATGACAGACCAAAAAGTC
TGTCCTCCATTCTGTGAGCTCCAGTCTTGGAGAGTACCGCCAAGAAATAGGCCGGCGCTGACGAAATGCATCGCTGAGGTTTTGGACAAGAACACTTTCC
GCCTATTCTCGGCACTGCGTCTCCATCCGTGCAGCCTCGTCCTGAAACCAGTCCGCAGGACGTGGAGTTATTTTGGAGCGGTTGGTCTGATGCTAACAGC
CAGCTTTTGACTTCCAGCGTTCACTGGTCTCGTGCCGCGCTACAACCACAAAGCGCCGTCGAGAACTGCGAGCAACGAGCACGGCATGTTGCCGGCGCTC
ACGACAAAGCCCAAACAGGCGGTGCGCCAAGTCAAAGGCCTGTCCAATGACTCGATCGATTCGTACTCGAACATGCCGCTCGGTGGGGGCGCGGGCATTG
GCGCAACATACGTGGATAATACTGAATCGGGCAGTGGAACGGCCCGCGGGTCTCCGCCAGCGTCGAATAGGTCGACAATCAACTCTGGGCGTGCTTCTGT
CGCTAAACCTTCAGCTAACGAGGAAGGTGCGACCTTGGCTCGTGTAGTGCGAGACCGAAAGGCTTCGGGTGAAGAGGAGCTGTCACTACGCACGGGAGAT
ATCGTCAAAGTGCTGTCCTCGAAACGCACCGGGTACCTCAAGTGCGAAGCAGGAGACGAAGTGGGCTACGTACCGTCGTCCTATCTGGAATTCCTGGACG
AAGCGGAGAATGCGAACGGCACTGCAGCATCAGAGGAGACTCAGACGCGTGCCGCTGAAAAGCAGCGCAAGAAACAACAACGAAAGGAAAAACGAAAGAA
AGAGAAGCGCGAGGTTAACGGTGCTAGTGACCCGGAAGAAGGAGCGCCAGTGTCTGCACGGTCTCCTCGTAAGGAAGTCCCTGCAGCAGAAGACGAAGGC
AATGAATCGCCACGAAAGAGTAAGAAGAAGAATCGGAAGCATCGTCCGGATCGAGAGGACGACGACGCAGGACGAGCGGGAGCTTCCGGCGTCGATGAAG
CTCCGACCAGTGCCAGATCTCGAGCAGCACCCGAAGACACTGAACGGTCTCGTAGTAAAAGCAAACACCCCAAGAAAAAGCGCCACCGCGATGCAGATAG
CAGCGTGTCGAGTGGAAGTGACGCAGGAAAACGAGCTGCACGTCACGGACGCCGTCGTCGCCATCGACGCGGTTCAAGTGAAAGTGATTCGGGCTCGACG
TCTTCTGATGATTCAGATGGGAGCTACCGGCGAAGACGACGCCGTCGCCGCCACAGACACCGACGTTCTAGTGAGGAGGAAGAAGAAGACGATAGCGACT
ACAAACGGCGTTCAAGACGGAGCAAGAAGCGTCGTGATAAAGGCGGCGGTGAATCTGAGCCTGAAGAAGGGTCTCGGTCAGCTCGGAAGGCCGAGAAGAA
GCTAGCTGCAGCCTTACAGGAAGCAGAGAAAGGAGTGAGTCAGTTAGACGTGAGGTCCGATGAAAAGGCATCGGAGCCTGTGGAGGCGAAAACGACTGCC
TCATCGAACAAGAAGGAGGAACCGGACCGAGAGCGAGGGAAGAAGGAGGAGACGGAGCGGAGTGAAGGTTCGTCGGAAGGGCGGGCGACGAATGTTTCAA
CGGGACGTAAGGACGATGAAGGGCGTGCCAGTAGCAGCGCTTCGTCTTCAAGCCAAAAGCAGAACGGTAACAGTAAGACTGGTCTCGGCAGGCAAATTGG
CGACAAGATGCGCTCATTCCTGGGTGGTAGCAAGAAGCAGCACAGTAGCAAGAGTTCAAGCGGCATTTTGAACGCATGTACAGGCACAGTTCAAGGCGAG
GAAGGCTGGTACGAGCACGGCGAGAACGAACGCTATTATTTCGTGCTTGTAGATGGAAAATGGAGTCTTCTGTACGGACCCATGACTGAGGACGACTTCG
AGGTATTTTCCAACCGGGTACGTTGCTTCGTTCTCCTTGAAAGCGGTCCTCCACTTTGTTCTGACCTTTTTGCTGTGTTGTGTTGCTCGCTTGCAGGTGC
TGGAGCAAAGCCGCTCCATCGAGCTGCCACCGACGTATCTGCACAAGTCAGGATACTATCTCAACCGCGAGCTGCGTGTGCAGAAGGAGAAGTGAACAGC
ATAAAGTACTATCAGCGCTTCCTCCTCCTATCACCTTCTATCGAATATATCATGCGAACGAAAGTTGCCAGTAAGCAATATGCATTATCCATTCATTAGA
AAGTGTTGGCTAGCCTAGCAAACAAGCAATAGATGCAGGGAAGCGCTTGGTATTCGAGTCCGTCGTTCTCTTACTTGGCTGCACCCGTGAGCGATGCGCT
GGGAGTCTCCAGGACGACTTCCTTCGGGAAGTAGAGCTCTGGTTTGATGGATTCCTCCTGGGGACCTGCACCCGTAAGCCACTGTGAGGGAGACCGCAGC
AACTCCTTCAGCTCCTCACTTAGCGATAGCTTGCGTCGTGGAGAAACAAGTTGAGTCGCCCTCTTGGGTTCGATCGACACTTTGAATTTCTCCGCCTTGT
CACCGCTTGACGCTGAAAACGCCGCATTCGCAGCAACCGCATTCCTCACGACCTTCCAGTTTGTGTGCTTCTCATGGGGCGATAATGGCTGCGCCACTCG
CTTGGAATGGGACAACTCCTTCCACGTTGTATCATCCACGGACTGATTGGCGATGTCATCACCCGTATTCAGATCCAAACGCAGACTGGATGCCTCCTTA
CGCTGTCCAAGCCGAACTTCGTTCAGCTTGCGGTCCACAAAGGTTGCCTGCAACTCAGGAGCTACCCTCTGGGCAGAAGCTGCCACCATGTCTTCACTCA
ACTCCTCGGAGCCTGCCTTGCCTTCCGTATGGTAATTCATTTTTCCTAGCAGCTCTGGCGTGCGGGTAATGCTGAAAGTGCCCTCTCTGTGCATCTTCAC
AAGTTCCGTAAGATGCTGTTGCTGTGGTAGCCAATGCGTTGCCACCTTGTGGTAAGCTTCGCGGTGACGCTCGTTCAGGCCATTGGGTACCACGCACACT
TGTTCAAGCTTGTGCAGCAGTACGGGCGTCTCTTCCGAGTGGAGCTTTCGGTTGTTCATGCAACGCTCTGCATGGGTAACCAGCTTCTCGAGTAACTCGA
GGTTGGACTGGTATCGTTCCTCAAGTTTGGCTTGTGCCTCCTGCTCGCGCTCTCGCAGTCTCGAGCACTTGTCACGCACCTCCCTTAGCAGCTTTTCCGT
CTTCACCATGTCCATTTTATTAGCTGCTTCAAACAAGAGCAGACGATCAAGCAGGATTTTCACGCCGACACCTTCTCCAAAAGCAGGATCGCACCATCCT
AGTCCACGCTGTAGCCAGCGGTTCCGCAACGTGAAGGCTGCAGATGCCCATTCCAGTCTTTGCCGATGCGCAGCGCTTAGCTTCCGCTTGATGCTCAACG
TCGATGTGTCGAATCCGAGCAGCCAGTCAGCAATGGACTGGCTGAACGTCCAGCGGCTCCACTGCTTTGGGATCGCAACGCCGTCCACGCTGCTGCATTC
GTCAAACGGGAAAGTGTCCTGCAATCGATTCTTTCCTAAATCAACACGCGAGCGGAAACTGGTTACCTCCTGGAACACGTTCGCAGCGTAACTGATGGCA
GCGTAGTGCGCCATGGCATGCGCATTATCGCCCTGTGGGCATCGAGCGAGCATTTCATCACTTGGGGTACGAATTCGACCAGCGCCAACTGCTTGTTTCA
GCTCCTCTTTCGTGAACGCCTCAGCAGGTAGCCGATAGTTCGCACCAATTACTCGCTTGTTGATGTTGTGCAGCTCCATAGCTATTTCTTCCTTGGTCAC
GGTCTCATCTCGAGACTTACCGAGGAGAGCTCGCACACAGCGATCCAGTGCTGCGTACGCAGCGAGCCTTTTAGTGTACGCTTCGTGCACTAGCAGCCGC
TGAAACCGTTCCACGAGCGTCATATAGTCGCCGCTCACATCGACCTCGGCATTTTCAACTGCAGCAGCGAACATGTCGGCTTCAGTCCTCTCATCTTCAT
CATCAAGCACATGTGACTCGCCGGCAAACGTGCGCACCAGCGAATTTCGCTTGCGCAATGCTTCAAAAAGCAATGTTTTACGAAGTATCTCGATTTGTGT
GTCGATAATACCCAGCCCGGTATTTAACGCCTTCGAAGAAGATGCTCCACTTGTGTTATCAGAGGCGGCACCTGTGGATTGCGTGCCAATACGAATCCCA
CGTAGTATCACAGGATCGCCTTTGCGGTCCATGCCTCGTTCCTGGAGTAGTGTCTGAATTGCGGTCGTGTCCGGCGGCAGGAGAACTTCTTTTACTTGAT
GCCGGTGCATAAGTTGCAGTAACGTCGTGGGGTTCGCTGTCGTCGGAACGGCTATGCCTTTTGCCACTAATACCTCCTTCTGCAACGTGAAGGCTAGTGA
TTTCACTAGATTCTCAACTTCTGTCGTTGGGATTTGCCGGAGTGTCATCTCCTTCAGCAACAATTGGTAATTCTCAGGCACGGCTAGCTCGCGATTCCTG
CTCACAGCATGATCAACTTTCCAGAGCAAATCACTTTTACCGAGACTCTTCATCGATTGGTAGAGCTCGGCTACGCGTTCCGGATTGGGTAGCGCGAATA
CTTGTTGGCTGTCATCGCGGTGCTTTTCAAGCATTTTCTCAAGCTCCTCAATCTCTTTCAACACAGTTTTCGGCAGGGCAACCGATTGCGATCCGGATTT
CGGATCTGCTAGAGACGGAGAAACCCACGCATCATCTGAATCGTTGCCTGTTGCATTCCTGTCAGCAGTCGGGTCAAAATTGGACGTTTTAGGAATCACA
CCGCGGTCTTCCAGAGCGAGACGAACATTCGCTGGAGTGAACACCATCTCTTGCTGTGTAATCAGTAGACGGATGTCTTTCCCGTCACGAGAGTAAGACA
GCCAGTTTCTCTTTTCTGTATCCACGGTAATGCGGTGATAGGGAATGCGCTCCAGTTCGTATTTTGCCTCCTCAATAGCGTACCATTCTGCCATACCCTC
AAGCTGTCCGTTGTCTTCGGCACCACTGTCAGACCTGATACTTCCATCGGATGATACCCGACTACTGGAATTTTGATGGGATAAGCTGCGTGGTCTGCCG
CCAGCTTCATCCTTATTTTTCGGTGAAGGTGGTGCTGCTCTGATCGGATTGAACAGTTTCTCAGGCTTGTTTAATTCGCCTTGCCGGTTGGCACGCATAG
ATCTCCACAAGTGCATCTTTTCAAGGATAAATGGTGTGTGCTCACAGTCGATTGAGTGCTGCTGCTGCATCTCTACAATCTCATGCAGCCACTCCTGAAC
TTGCTCCCATCGGTTCTGCACAGTGTTAAGTGCCCTAGCATCCACGTCCGCAAAGCCCTCGCATTGCTCATCTAGAAGCAGCAACAGCTCGTGTGTGCGT
CTCCAATGCAATCCTTTCTTTTCCATTAGCCGCAGTTCGCTGAGAGGACCATTCGGCTGCGTAATAGCCATCCAACGGGACTGGATATTCGAGACTGCAT
CGGCGTGGCGCGTACTGAGTCCTTTGCTGCAACGCTGCTCCACAATTTTTAACAGCTGCGGTGCGCGAGTCAGGTTGAGCTTGCGTTCCTGCATGCTCAC
GAGTTCCTCCAAAGCATTCAGCAATATTTGCCACTTTTGTTTCACCTGCTGCCATGCTGTGCTGAGTCCAACATCGAGGCCCTCGATCTCCCGTTCAATA
TCGTCCAGAAGTTCAGGTGTACGTTGCGCGTGAATCAGTGCGGCGGCTTGAATAGTCATGAGTTCCTCCAGTCTAGGTTGCATGTTAACCCAGCGTTTGT
GTACTTTCATCACCGAATCTCGATAGGCATTTGCCACTTGTGCAACACTCTGCGTATATTCTAGCTCTTCAGCGTCAATAGCCTTCTTTTTGACGTGGGT
TGGCGAGCTCTCCTGCAATGCGAAAATATCCCAAACAAGGCTGAGCAATACCGGGGTGCGTTCCCAGTGTAGTTTACCCTGAGCCTGCTTCGTGAGCTCG
TCCAGGTAGCCTTTAATCGTCAGCCAGCGTCGACGCTGGGCCGGCACTACTGCAGCATGGAGACGCCGTCGCGCTGCTTCATGCTGTGCAAGATACTTAG
CTTTCCATATCTTGTACACATTTATGGCTTGCTCAAAGAACGAACTTTCCGAAATCTTCAGATGGAGTCGTAAACGAACTTTGCCTCTGTCTTTTTCACC
AGGACTGTGTGTAGCAATTCTGTAGCCGCGCAAATTAGTTGTTGGTAAATACAGAAGTTGGTACATGTCGTCACGGGGCTGCTGATCAAGAAGATCCATC
AGCGGTATACAAGCGGTGCCTAAATAGTTGTCGACGTTGTTACGGTCTTCATCCATCACCTTCACGCGAACTGTGGCTCTCATGATCATGTCAAGTACCT
GAGTTAGTTTTGCAAGTCGAAGCCGCTGGTACAGTCGCTGGCGAACCTTCTGATCCTCCAACTCCAATTCGTCCACCTCGTTGTTGAAGAACGACAATAA
TTTTTCGCCCGTAGCGACATCGACTCGGTCTTCCTTGGCGTCCAAGATATACAACTCGTTCAGCTTCGGCATAAAGTGAACAATAAACACTTCGTACAGT
TTTAGTACGGCGTGACGCACTCGATGAGTGCATGTTGCCACATTGGCTTCCACAATCACCATGTTGTCGCGAAGCTGGCTATCATCTCGTCCCCATGGGC
ATCAGATGACCAGGGAAGCCTTCGGTCAATGAGCCCCAACTCCTGGGCGGTGTCTTTTACAAGCGATTTCGTTTGTTGCAGGGTAAGTCGCAACTGGTCA
AAAGCGAGAGAAGTCAAGTCAGTGCTAATTCTGTTGGACGCGTTTGGAGTCGACACAACTGCTGTTGAGGATCCAGCAAGCGTTGTTGCATGCAGCTTGT
TCATTGCGTCAAATATCAGCCGAACTTTTGTGATTTTTTGTAGCTGAAGCTCCATTTCAAGTGACTTCTCCAGCAGTATCTTCCCTCCACCAGAAACAGG
AGGCCCAGTAGCTAGAAAACTACGAGAGAGCTTGTTCTCATGCTGCTCAAGCGTCATTTTGAGCAGCTCCTTAGGGCAGATAGCCCAGAAATCCATGCTT
TTTTCGAGTTGCTTGGCGTACACTTCGGTCTTTTCACCGTAACTTTTCATTCGCGTGATACTTAAAGAAATGGTTCCAACGACGCGCTTCCTATCAGATC
CTTCGTGCTGCACGCTGAAAATCGGTTCATCTTTAGGCTTGTCAGCATTATTTGTTGAGCGAGAGACGCCGATTTTTGCCATTGGAATGGTGACGATTCC
GATCTTTGTGTTCGTCTTCTTGTCCCGTACAATCATCTTCACATCAGAAACACGATCCAAATCAATAGCAGGGTACGTAAACTTTAGCTGACTGTCCGGC
TGGAGCGCATACTTATTCTTCCAAGCCACTGATGTCGTTAATGGCGTTGACAGCGTTGTCCCTGCTGCCGTTTTGTCGTTTGTCAGTGAAAATACCGAGT
TTTTCGGGTAAATCTGTTTGTCCGCATCCGGCAAAATTTCGCCTGTCGAAGAGAGCGCCAAACCAAATGGTGTAGTAACCTTCTTGTCATTAGCCATGTG
CTGCCGAAAGTCACTGGAAACGAGTAGCACTTCCACAAGCAGCCCGTCAGTTCCCATCTTTTCTTTTAATGTCATGTTACTCGCTTCCAGAACTTGCACA
CTGAGCTTGTCGAACTTAATGTCAGCTCTCGGTACTTTCACAGCGGCAGTATTAGGAGATTTGTTCGCGCTCGTCTTCTGGAACTGAAGGTTGCAGTGAG
ACGTGGCAAAAGGTCCAGGAGCAATGTAGGCTTTGTGGAATGGAGAGAGTTCTCTGCGAACACGAGCTTCTGCCAATACATCGTACATGGGGAAATGCAG
CTCGTGAACATTTTCGTCGAAATCACGAACACTAACACGGATGTCATCAAGAGGTTCGAGTTCAAGTGAAACTTCAGGTTCAGAATCGAACCTACCCTCC
GCACTAGTGAAGTCAACCGATAGCGCCATGCTGGGTGCTATCATTTCCTCAGTAGCAGCCAGGAGCCACGGCAATTTGCCAAGATCTCCGAAATCTGTCA
ATGGTTTGTCTCCTTCCACGGCAAGTGTCTTTTTGAGCTTTAACCGTCCCGAAATACCAGTGGCTTGTGCAAACGAAACATTCACCGCATCGCTGATATT
CCCGTGGTCATTGTGAGGCATCGATAAACGGAACTTAATCTCGATGGTGGCATTAGATAGCGCCACCCCCGTCAAATCGGCATTATTGTCGCCTACTGAT
GTGTTGTCAGAAGGCGACGGCATCATGTTTACGACCACACTGCGACTGGGAGTGTTGTTGAAGTCTACTTTCACAGCTTCGATCATTACAGTACGTCCTT
TGCGATGAAGCTGAGGGTCGATGTTACACTCCGCACGCAGAAGTCGCTGAAGGATGAACACAGCCGAGCCAGGAGTCTTTCCCAGCGTAGCCAAAACCAA
TGCCTTGAAGAGTGGGCCCGAATCGGAACACGAACTCACGGTGACAGCTCCACGAACTTGCACGAGCGGCGGCGGCGCCAAAATAAGGTAGAAGCAGTTT
TTCTTACTAAATGGTAGTGTGCCATTTGAGAGTGTGTTGTGCATGCGACGTTTACAAGCTGCGGTGTACACCAGCTCAAGCTTCTCTTCCTCTGCTTTGT
CGAAATTATCTCCTTTCACAAATCCATGGTATTGGCCTAGGAAACGTGGCTGGTCCTCGCTTCTCTCCACAAGAGCTGATTGAAGTAGCTTGTTTGTGGT
CGCATCGCGCGCTTGAATAGTTTTCACAGCAGAAGGAAGCATTGCATACACCTTAACAATTTTGTCACTACCCCACCAAAGGTTGTTCAACTTATCAGCC
ATGGTCGTGGTTGAAGACGAAGGCTGGGTTCCTGTTTTATCCAACGTCTGCAGACTAGAGCTGAAAACGGACCCCAGCAATGCCGTGTCAGCCGCAATAA
ATTTCTGGCGTGTACGCAACTGAGATCGCTCCAAATTATCGACCAACTCGCCACTCTCGAGCAATGTGCTGTACTTCGCTGTAGAAGGAGAGTCATCGAT
TCGACTAGTTGGGTGATAAACACTGCTCACTCTTCCATCATACATGATTCCATCGGTCACTGGAAGTAAGCGCTCTCGTGTCACCAACTTCTCGTCCTTG
GGTTGCTGGCCATCCAGGTACACGATATCATATCGTGCATTACCATAGTTGTGGGAAACTCTTGCAGGCCGAGTAGATCCTGTCTTCGTAGAGGTTTTCT
GCGGAGTGGGGTTCGCAACCCCATCGTCAATTTTGGCCAGGCCAAGGGTCGAGTGACGCCTATCTCGACTCTCTTCCGGCGAGACGACCGCGCCCCCGTT
GACTCGTACATAGTCTTCTTTCTGTAGCTGTCCCTTCAAGACCCCGCCTTCTACTTGCGACAACGTAGCTTCAATAGAGTCGCGTGGTTGCCACTCTTCA
TGAGGTTGTAGGTGGTCGAGGTACTCAACCAAGTAAGGGCTTTCTGGATGCTCTTTTTCATCGAAGTGTTTTAACTTTGCGAGGCGCCCCTGTTTAATGT
CTCGAACCCGGCGATTAGACACTTCGGGATCTTTTTCATCATGAAGTGGGCATACAAACACAGTTTCCTCCATACCAAAACCCGTGCAGAGTTTTATATC
GTACCTACCGCCTCCCCATTCCTTGGCAATAATCGCGGCAATAAATTGGCCACCAGGTAGTTCCACGTCCACAGGCACTCCAGCATGCTTGAACAAAGGT
AACTGAGCCGTGACTCGATCGCCAACGTGCAAAGGGCTCGACCGCTCTTCGCTATTGCGACCCGCACCAACTGAATCGCCATTACTGGAGGTGAGACCAC
CACGAAGAGACAAGATATCGAACCCCGTCCACTCACACTCTGTGAAAAGCGCTTCGATCAGGCGTGGTGTCTTCTTGCCATGTAGGTGCCCAGTCAAATA
GTCTTTCGCCTCAGTCACTTGAGTGAGTACGCGTGACCATCGATTGAGCACTGCGTCCACAGCAACTGCATTTTCATAGGAGAGCCGATCTTTCTCTCCA
CTTACAAATACGACTTCGAACACGTACGCAAGTAGTTGCGGTGTCACTTTCCAGTGCAGCTTGGACGCATGACGCATGATGCGCACCTGGGCAAGTAACT
CGTCGCCAATATTACGACCAGGAAACACGTTCGTTCGACAAGTATCCCACAGAAAGGTGTGGACATCCTTTTGAAGTTGCTCTGGCTCGTACCGCCCGCT
GTTTTGGTTTAAAGTCCGAGAGTCAAACACAAGTCCAACCAAACGGAAAGTGTCTGCCAATATTCTCCTTACGCGATCTGCCCGAAGAATTCCAATCAAA
TTGAGATCGAACGTCAACGTCGCTTTTTGCTTCGAATCTCGATCTGTCAGTACAAGCTTTTCATCTCGAAAGTTTGCACACTGCTCAGGGTTTTTCAACG
AGAATTTGGATTTGCTACCCTCCGCTTTGCCTCCTGATTTGCGTTCCATTTTCCGGTCTAATTTGCCAAGCTGACCCTCATAAACTCTCCCCTGTGACTC
TGAGACTAAGCGTACGTCAAAGTAATCCACTTTTGATAAGTCGTATGTACGGCCCAGGATGTTGTATGCCCCACCAACCGAGAAAGAATTCGCCTGAAGT
GATTTTCCGATTTTCGCGGTATCAGAGCTCAATAGAGGTGCTGCTTGACGGAGAAGTTCGCTGAACTTGTATGGGTTACCAACGCCGAGGTCTTCTGAAG
CAGGGTCGTATTGGATTCGCAATCCTCCTTCGCCATGAGGCTGGAAATAACACGTATACTCGTCCCAGTTTTCGTCCTTTAGGTCGACATCTTTGATCGC
CACCTCTGCAGAGTACGTTGTGTCGAGCTGTTTAGCATTCGGGTCCACGTAGTTTTCGTTGCGCATTATGTCCACCGAAAAGCGTAGTTTACCAAGTAGT
CCATCTGGGGCTGGTGTCTTCTTTGTTTTAGGCTTCGACTGACCTGTAGCTGGAAGTAGCATCGCCTCAACCTCAACGCGGCCATATTCATCCAGCGTCA
GTTCTTGCATAATAGTTCCCCCGAGAGCATCAGCCTGTTTCAACACGACCCCTCTAATATAGCCCGTTTCGCTTCGTTGAAACTCGATGGTTACGCAACC
CAGTGGGTCATTAGCCGATGTTTGGTCGAAGTCCATCACACGAAGTAGCAGTGCCTTCTTATCCCTTAGCATGGTTTTCTCCGTTTTACCGAGCAGGAAT
TCTTGGTTCTCCCACTTGGGGTTTAACGTCTTCATCTTGATGTCAGTTTTTAAGCTCGTATCCCGCTCCTTTGAGTCATCATCTATCAGGACCATCTCCA
CAAATGGGTCGCTTGTGAAGAGGTCTGCTACACGTAAGCTTCGGCCCTCCAAAATCGATACCTTCACGAAGGATGGTTCCAACCCCACTACAAATGGGAT
TTTCTTCTTGGGATCTCTTTCAGCGTTACCTTTTGGGGTCAGATTCTTTTCCTGTGGTGGCGGCGGCGAGACCTCGCTTATAATTGCTTCAATAAGGGAA
GGAACCTTCGCACTGCGCTTGATATCTCTCTTGTGCACAAGCTTAAGCTCCACCCTTATTTGACCAAGGCGAGTTTTCTGAAGCATGTCACTGGCAGGTG
CAAGGGGATACCATGCATCGACCGTACGATGAGGTGATATCATCCGAATAGGGATCTTTAGAACGCCTAGCGGCTTGTGGCGGTATCGGTGCTTCACCAT
GCGCGAAACACAATTCTCCAAATCTGTAGCCTTGAACAGAATGTTCAGATCGGTGCACTATCACTAACTTTATGAGGGTCCAAATCTCCTTCGCTCGTGC
GAATCAGCTCCCGCATCAGCCCCTCCTCGACAATCCGTTCGTTATTGTGACTGTATTCCACGTCGTACAGTAGGAACATGTCACGCTGCGCTTTAGGGAG
GCTCAACCACGATGCTTTGTCTGTCACCTTGTACTTGGCCAACAGGCTGCTCAGCGATTCTGGAACCTCCATTTTGTTCGAGATATCGTATTTTGCTGTG
AACTGATATGTTGGATCGGTGAATGGCGTGCGAATCCGAACAATGCGTCCAGAATACAACGAGTCCCTCTTGAAGTTTCCACTTTGCATAGGCTTGGACT
TCAGGTTTTTGCCTTTGCCATAATATGCCATCACGGTCTCACCCACACACCCTGGCTTTTTCAGCTCTCTCCGCACTTGTGCACGGAGCTCGCGCGACTT
CTTTTCATGATCCTGGTGCGACAGCTCCCTGTCGTGCCCAAAAACACAATTCAGCAGCCGGTTGAAACTTCCTTCAAGATCGTTGTGATCAAACTCTGTG
GCGTGCTTAATACACTTTTGCTGCAAAATTGTAGGGTTCAGCCGCTTCATCAGAACCATTTGGCCAGGACGCATATCAACGCAAACGCCTGAGCTTGTCA
GCGCTTGGATCCACTTTTGAGTATGTGGGGTTTTAACTTCAATGACTTTGTCCCCCTTATCTCGTGTCCTTGCCATTTTGTCGAGATTTTCAGCGGATAT
AGAAACGAAGTCTTGGGAGTCAGGCTTTCTGACGCACACTGTCGGATTCACAATATCCATCCATCCTCCTTTCGCATCGTTCGTGAAGTTATAGGCTACT
TTGCAAGCCGCACTTGCCATGTCAATGAAGGCCACCGGTGTCGTGGATGTTTCTTGCTCATACATGTACAAGTGCTTACGACTTGGAACGAAAAGGCAAT
ACTTCCAATCCCACAACACGTTTTCTGCATACTCTTCAGCTTTTTCAGCAATCGTTTCGGCAACGGGTTGTAAAAAAGAGTTTTTCCTAATATCAGGGGA
GAATAGCGTACTGGATGCCAAGGTGTGCATGCCTAAAAAGCCGTCGCAGTGCTCAGTAAGTTTTTTTGCGTACGTCTTGCTTCGTTTGTTTGTGATCTGC
TCCTGTTCGCTTGAGCTATTGCCTGCGTTCTCGTCCACAGATCTGAGCACAGGTAAATCTGAAGCTTGGTAGCAATCGATTTCTTGAACAAGATCGATTG
GAAACAAACTCTTTTCGCGTGACAGCTTTTCCATCCACATATCTACTTCACGCAAGCGGTAGAAACGATCCACCTTGTATTCCAGCAGTACTTGCCTTTT
GCCGAGGTCTGTAACAGCAGCAATCCCTGGAGTAACGTTTTCCACAAAACCAGCAGCACACAATGCACTAAGCCACTGCAATGTGTACTCGCGCGTCGTT
GGTGCTTGGATTGCGTCGGGATCAAACTCCAAGTTTGCGTTCCTCCACCCTAACCGACACGAAGACTCAAGGGCACTACCCCGGCAGTATTTTGTCCACC
CATCTTCCCAAAGGACGGGAGGGTGACGCAAAATCCAAGAAATCATACCTTCACCTGTGAAGCTCCGTGGGACCGACAGAACTAAAGCACTCGTTTGGTC
CCTCATGAAAAAGCTGCCGCTTTCGCGAAGGAGCCTCTGTCGATCAGCGCGCAGTTTGACCCATTCTTCTCGAGGAATATCAGCGTCAGGGAAAATACGC
GGGCCAGTAACTCCTGCCAAATCCAAGAGCTCATTTTCCAACCCGGCCACTACCTCCTTCCGTGCTTCTAGCGATAGCTTGTCCATCGTGCAGCCGAGCC
ACTCGCTGGTCGGATCAGCATTCACGGTGTGAACTTGGCGACACTTACGCATGTCATCTGCGGAAAGCACCTCAAACTCTTCGAACTGACGAATCTCGCG
TAAAATGCTTACGATCCGCTTCATGATGACCACGAGCACGGCGTGAAATTCATCGATTTGGCAATTCTCCGTGGGAGTCAGCGACGAACGAAGAATTTGT
CGTCGCTCAATCCAAGTCACTCCTCGAGTTAAGATAGATGATGATTGAGCTTCAATTTTCACTTGGCGCTGGTACCACATGCTCAATCCACACACGGAGA
GCCGGGGCTTAAAATCTCCTGCTTTGGTAGACGCTTGCATTTGTCGTGGCTTAAACGTATCCGACCATGTAGTGATACGAAGGAACAGGGATCCCACAAA
CTTATAATAAGGCACGTTCGTCGTATCGGGAGGGACAATCTGCAAAGTTAAGTCCTGCTGTCCACTTTGTAGCATAGCGAGATCGACTTTCACAAACCCA
ACCGTTTGGTTACCTGCAGCGTCCTCGTTGTCCACACGAATCAGGATGCTCGAAGCCTGTTCGAGAATCTGATACCCCATCTTTATTTCATGCGGCTCAA
CAGGCTGGTAATCAGTGTCCCCAGGCGGAGTGGCATCCACCCTACCCATTACCAAGGGTTTCTGCTGGAACAAATGCACATCATCGGTCTCTGCAGACCC
ATGCAGCACAGTAGCCGCCAAAACCTCTCCCTTTTGGCAGTTCCAGTTAGACAGTGTCACTGTGTCACCCGGAATGAGCTCACCTTGTTTGTTAAAACGA
CACGTGCTGGATGCAACCTGTTTTGGGTTGCCAAGCATTGTAATTCGGCACGTAGGCTTGCTGGTCTTATCCAGTTGTTTGAACTTTTGCGGCTTTCCGG
CCTCATTTACAGGCACCAAAAGATCCGACGCCGATAAAACATCAATGACAATTCCAGAAAACTTATGCTGCAGCTTCAACCACCGCTCATCTTCTTCTTT
CTCCATGTCAAAGCGTCTGGCCATTACCATCTCGACCTTGTCCGTTAAACTGTTTATCGGAATGAGTTGAGTAGGCTTTACAGTGTACCGCAAAGTACGC
CTGGCTGAATTTGCAATAGCAGGTAGCTCGTTCTCAACGCTCACATCCACTCTACCATCACTGCGCACCGCCTGGACTGCTCCTTTTACATCGAACGAAA
TTAGGTTACGAAGCTCATCGATTGTATCAACTTCATCTTCGAAATGGACATCGTATACATCGTCAGGGAACGGAATGTACTTCTGAACACGAGCCGGGTA
AAAGCGTCCACCATTATCGCCACCACGAAAAGCCAATATTCGTTGACCGTATTGCAGGATCTCGAAACCATCGTCATCAACCTCTCCGGATGGCGTCAGT
TTATGCAGTTGGAAGCGTTTAAGACGTGCGTCTTGCTTCTTTTCGTCATGGTTAAGCAATTTTGCCAGAACCTCCTTCTGATCATTCTGCAAATCTCGGC
CGTATAAGTGAAGCGAGAGGTACGATACATTGGCAATATCCTTGATCTTCCCAAATACGAAATTCTCTTCTGGCCAAGATGGATCGCGTGTGTTGTAGAC
AGTCAGACTTTGCTTTCGCTCGGCATCTTCCAGCCTCCCGTCGCCAAGGACAGGAATAATGGTGAAGTAGATATTTGTCGCGTCTTGAGCACGTTCAGCG
TTTCTCGACATTCCATTTGTCTGAGAATCGTGAACACCATCAAGCTCGAGTGAAGACGACCCAATATTGGCACTTCCTGCCGTCTCCGTGAGTAATAAAT
TTCGAGCCTCGTGGACACGCAAGTGGAGTACATGAGTTTCACTGCTTGGGTACTTAGCATCACTGAAAACTCCAGGATACGACAAAGAGAGCGCGAACTT
TTCTTTGCGCCACGTTGCTGTTGTACCGAGAACCCTCGAAGTAGATGTCTGAATAGGCAGTCCGCGCTGGATAACTTCCGTTGTTTCGTCTTCTAGCTCA
GATCCGCCGATATCTGTCGCTGACATATCCATATCCATTGAAACTTCGCTTTGGATATTTGCTTCTGAGAAGGTGAGAATACTTAGTGACTTTTCCATCG
GGACAGTAGACACGCGTTGCATTAGCTCCGCCAGAGCGGTCGCATCTCCAACCACTTCGGTTTTTATACACAGCTCTCCCAAATCCTTGGCATGCTTTTT
CATCCAAGGTTCTGGTTTAAGTTCATATCGTTTCATAACTGTTTTCGACGAAATTGAGGTAAAGCCCGCAGATGCCCGACAGAGATCATACAAAGGAATC
TCCACACGCCCAAGCGGAGTGCTCCTCCAATATTGTTGTGATCTTTAACGTGGATCAAGAGTGACTTGGCATCTGAAAGCGGTACGCTCTGTGAGAACAA
ACAACAGCAAGTCAATAGAGTTATTCGCACAAATCAAAAACTACCGCGTTTCACAACTTACGTTACCAAACAGGAAGTTCTCGTTAGTCCACACTGGATT
AAGCGTCTTCGAGACCACTGCTGTGCGCTTCTTTTCAGCATCGATAGCCTTTCCGGTTTGATCAGTGATAGAAAGTGTACAGTACGGATCGCTGTAGCCA
TTCATGTCAGCCGGGCTGAGCCCGTGTCCCGTGAGGATTTCCACTTTCAGAACTGGTTTGTCAGGGTTAACCTCCAGCGATTTTTCCGATCGCATTTCGT
TCTTCACCAGTTTTGATCGGTGCAAGGATACTTCCGCCTGGGAACGTTTTGAAAACATCGTATTGCGTGCCTCGGATGCAGCAGCAGCAATCCGCTTGCT
TTTTTGCGGAGACAACGGCGCACTTGTACGTTTACACCCCTCAACGCATACTGATGGGTCGATTTCGATAACAGCGTACGGAGTCGCGGTAGTCCCCGTA
TCACCACCTTGTTTTTGCTTCTGTTTCAGATCGGATGCCTCAATTACCGTCACTTCAAGTACTGCCTGGCCTTCCAAGCCAGCTCGGGCCTGAAAGCCTT
CATCGGATGATACTTTCTCTTGATGAGCACGCGGAATCTGAGAGTTCAAGTAATGAATGCAACCGTTGATGCCATAAAAGCGAGGATCCCGTGCCTGGTA
GTCGGTGACAGCACACGGATACGCGCCCCATCGAGCTTACAAGCAGCATCATGCAGCTGGAACTGGGCGTTTTCCAACTCGAGCTGCTCAACAGAGATGT
TGTGTCTTTTCGTGTTTAGCTCCTTTTCGATCTTCAGCTGACGAACATGCTCTCCACGTCTCTCACCAATCAACCAGATTTTTAGCTGTATCGCACCAAG
GTTTTCGCGAACCGACATGCCTTCTTCAGGTTGCAGTACGTGCCACTCTGTCCACTTGTGAGCCGAAAGCTGATCCAGTCCAATGTGAACAAACCCAAGG
GGGTCATTTCGGTTGGACTTGTCGTAGTCGACTACCCTTACTTTGAGGCTGGCTGCCTTCTCAATGTGGCAGATCAATCCAAACACGTGGTGCTCGTCAG
CCCATGCAGGGTTACGCGTCCGATGCATGATTGCAGTCGTGGCGTATTCTCCAGGGATGGGTTTTCCATGATCATCTAGCAGAGAAAGCTCGCAGTAAGG
ATCCGACGAATTGTTGAGGTCGGCGCTGATCAGGTCCCTCGCAGCTATAACAGTCACTTCTAAGCGGTTATCTGTGTGCTCGTTACTTGCCGTAGCCACA
GGACTTGTCGGAACGAATGCCAAGTCTGAGCTGTGGAAGAAGTCAACAAGATTGGGCCCAGATATGCTCATCTGAACGCGCAGCTCTCCCCAGTCCTTCA
CGACGTGTTCCTTCTCCCGGGTATCATTGCGTCGAGGAGACGACGATAGACCAGTTTTCTTCGGCGGCTCCACACGAAACCAGTCGTCGATCGGCTCCGA
CTGAGCCGTGCTTGCTGGGGACATGCGGAACCTCGAGAATGGCACCTGGACTGACCCCAAGCTGTCGTGACGCTTGAATGTATCATGATCGAACAAGTCG
AACCGAATAGCCTTCACTGAATTCAGGTCGACAACTCTGCCAATCTCGAACGGCTTCCTCCACGCCGGCTCGAGAGTTGCCGGGATCACCTCAGTGCGTT
TCTCCTCGACGTCGATGACCTGTCCATCTTTGCCCACCAGCTTTACGACGCAATACGGGTCGCTTTTCCCGTTGAAGTCTGCAGCTTTCAGTTTGCGAGC
CTCCTCCACAACAAGCTTGAGTAATATACGCGAAGGTGGGGCTGGAGCTGCAGGTGGCTGAGGAGGCGTCGGTCCTATCGAAGGGGCAGATTCCTCCTTT
GGCATCTCGGGGGCTAGTGTCTGCTGAGCTACATCAGGAGTCCGGCGGTAGGCGTTGTAGATAGCCGTAATCCACTCGTCCTTCTCGACTTCGTTCTCTG
CCTGCATGTAGAAGCTTGGTTGTCCAGGTGCAGGCTGGAACAGGATGCAGAGCGGATATCCCTGGTCATTCGTCCGGAGCACACTTGTATCCAGCGTAAG
CTCGTAGCAGCGCCGTGGCGCTGTGTCTTGCGGCGTTTTGTAGTACAAGAGCTCGGTGCGAGTCAAGCGGAAGTACCTCCGCCGCCAGTTCGACACGACC
CTGCCCGACCGGCTGCGCTTCATGAGCCATCCCTCCTTGATGTAGCGTTGGTCACTCATCGCGGGGAGACGGCAGCGACTTACTTGTCTCCTCTGTCTTC
CTAGTGCAGTTCTTCTCTACTTTAGCCCGCCGTCACTTGCGCGCTCGCTGTCTTCTTATCTTCTGAGGTGTCCGTGGCCAAAGATCGCGATCACCTTGAA
GCGTCGTCGCGTCCCTCTGCGGACAGCTCGGGCGGTTACTTGATCCCGACCAACTTGTCATGCATTTCGTGCTGCTTATCCGATAAAGCTACGACTTGGC
TCCTTTCTGGAAGAAAAGCGGTGGCGGGAGCTCTAGGGGGAACAGCAACTCGCTTTTGATAGCATTTACCGGTGCATTTCGAGAGGACGTTGGCTCTCGG
CCGGAGCGGTGACTCATGCGTCGCGGACTCGTTGCACCCTTGTTCTGCTTGTAGTAAATCAGTTTCCCCTCAATGCTGGAGCTCGAGCTCTTGGTCGTTG
GCACCTTCGCATCAGTCCGTACGGCACCAAGTTTGCGACTGCCTCTCAGCGCCGACTCGGCTGCTCTGTCCTCGACGAGTGTATTCTCGTCACACTGCAC
ACTCGAGTCTACCTTCTCCAGCTTCTTCTCCTCGTCGCTGCATCTCTCCTCCTCAACTCGCTCTACTGCAGTCGCTGGTCGCTGCGTCTGCTGCTTCGTC
TCGTGTTCCACCCGAGGACTCGACGGCTGCGACCTGTTCACTTGTACACCGAGCGCCTTGGTGATGTGCGGGGCCAGCGCCTTCCCGAGACACGAGAGCG
TGACGGCTCCAACCACGTGCCCCACAACGGCGTTGCGGTGGTCTCGGAGCTCCCACGAGTCGCTGTGGCTCGCCCACTCACAGATGCGCAGCAACCTGCT
GCAGCTCAGCACGTCGTCCTCTAGCCCCACGTTAAGAGGCAGCGGGACAGCTGCAAAGGCTCGCAATCGGGCCCTCCCGCGCTCCTGGAGCAGCAACAAC
AACGTCAGCGGCGCCTCCGCGTCCTGTCGGAGCTCGCGCACGAGCTCGTCCGGCTCCGCTTCGAAGAGACAGGATTTGCCATGCTTGAGTCTCGTCACAC
AAGCTTCACTCTGCGTCTGAGAGGCCTTGGAGGGCGTCAGCGGCGTGTCGAACACGACGATCTCGTACTGTAGCAGCTGAAAGCCCAGCACCAGCGCGTT
CTCGAGCTCTGCACAGGACGGTAAGGCCGTTAAACATACTCGGTCCACGTAGAACTGCAGCGAGAACAGCACACAAGCAGGTAGACGGGCAGGAGGTCCA
CTGAGCGCGTCGGAGTCGCCGGACGTCACAGAGAGCGCGCCATCTTCAGCGTCCATCGATTAACTGATATAATAGCGGTTATGTTAATGTGTCTGACCTG
TCAATACCGATACTTGAAGATATCGTAAACCACAGGGCATGCCAATGCATCATCACCTCACATTTCCAGCAGCTTCCGTCATGCTGCGTCGGTTCTCCTC
GTCGGCGGCGCCGCGCATGGTGCAGCAGCGCGTGCAGAGCCAAGTATCGCTGCTGTCCAAGAGCTCCACTGCACCCAGCACGCGCGTCGTGTTCGTGTCT
CGTGCTGCCGCGTCCGACGTGCAGAAGTCGCTGCCGTTCCCCGTGTCCGCTGCTGCGCTGCGCGACTTCCAAGCCAAACCGCTCGAGCGAATGTTCCTGT
ACCCAAACGAGGACGACGCCACGCTCCAGACCCAGCGCGTGCTGCTCGTAGGCCTCGGAGACGCCGAGAAGGTGACGCCCAATGTGCTGAGGAACGCCAC
GCACGGCGCCCTCAGCGCGCTCAAGGCCAAGCGCGCCTCGAGCGTCGTGTTGCAGGTGCCCAGTCTGGAGGGTGGAAAGATGGACGCCGCTCGAGTGGTG
GAGCTGATGTCCCAAGCCTCGATGCTGTCTAACTACCAGTTCGACCAGTACCTGACGGAGGCCAAGGACGTCTACGGAGACAGTAAACTGCGCCTGCCAC
TGGAGCAGATCTACTTGGACGCGTCGGCTGAGTTCCAGAAGGTCAAGTGATTGCTGGAAGTTTTTTTGTAGTGTTGAAGGAGACTGACCATTGAGTGACA
TTGCAGAATGTGGCGGAGCAGGCGACGGTGGGCGAGGAGACCATTTTCGCGCGCAACCTGGGTGCGTACTGATTAAGAGTTGGCCACGTTGTAGTTCTGG
GCTGACTTCGGTGATGCAGGCAATGAGCGCTCGCACATCGTGAACCCGGCATTCATGGAGGAAGTGGCGCGTGCTTCGGCCGAGCTCCCCAACATGTCCG
TTCGTGTGCTGCAGCAGGAGGATCTGGAGAAGGAGGGCATGAACATGTTTCTGAGCGTGGGTCAAGCTGGCATCTGCCCTCCTCGTCTGGTTATCCTCGA
GTATCGTGGCAACCCCGAATCCGACGAGAAGATTGCGCTGGTGGGCAAGGGTGTCACGTTCGACACGGGAGGCCTGAACCTCAAGCCTACGGGTGCTATT
GAAGACATGCATACTGACATGTGTGGCTCGGCTGCTGTGCTGGGAGCTGTCCGTGCCGCTTCGCGCCAGGGTCTTAAGGTGAACATCGTCTGCGCTCTTG
CTCTGGCCGAGAACGCCATCGGATCAAAGGCCGTGAAGCCACTTACGATTGTCAAGTCGCACAAGGGAATCACCGTGGAGAACAACAACACCGATGCTGA
GGGCCGCCTGGTCCTTGGAGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCCCAAGAAGGTTATCGACGTGGCTACTCTGACTGGTGCGTGCATGATC
GCTCTGGGTGAGCACTGCGCTGGTCTATTCTCCAACTCGATGACCTGGCCAAGAAGCTGCAGGAAAGTGGTACCGAGTGTCACGAGCGTTGCTGGCGCCT
GCCAATCCTCCCTGAGCACACTGCCGCGCTTAAGGGTACCCAGTCGGACTCCCGCAGCACCGGTCGTGTCCGCTACGGAGGCGCCTCCACGGCTGCTGCT
TTCCTGCAGCAGTTTGTTTACGAGGGCGTGGATTGGGCTCACCTTGATATTGCTGGGCCGTCAAATTACAGCTCTGCCAAGTCGTACTTCCCCAAGGGAG
CTACGGGCTTTGGCGTCCAGCTGCTCTACAGCTACTTGAAGGAGCACGAACAGCACTAGAAGGTGCTATCTGCCGCCGGTTTTGTTGTTACTCAATAGAA
ATGGCAAACAGGAGAGGCGTGTTGAAGATGTTAATGGTGGTTAGTGCTCTGTGTACAGATTCCAAACGAAAACGCAGCCATCATCACCTACAGAGACAAG
CTGACGATCGTCTGGGCTGAAGGCGAGGCCGCGAACATTGCCCGAGTGGCCTACGCCGTCCATGATCAACTGGTTGGTGTTAAAGTCCCAGACTTTCACG
AGTCGATCGTTCCCACCGGTGGCAAACACTTCGAGATTGTGCGCTACAGCGATGCAAGTGGCCTCTTCGTCGTGGGCCTTCTGGATCACGGTCACAGGTG
TGTCGATGCGCAAGTCCCAGTAAGATATGCGCTTTTCCTGGCCAGCACTCAAAACTAGGTGTTGGTCAGCAGACAGCGCCACAGTGTTGATCCCGCCCAT
GCGCTGGATGTGACTTGAAATTCTCCGTTCATTGCGCAGGTCCCAGCAGAGCAAACTGCGGTCTCGACTGCAAGAGATCACGTGCAGATCGTCGCGATAC
AGCGCCAGACTCGTGACTGTCATCGAGTGCTCTTTGAGGTGTGAGACCAAGTCGCGCTTGCGAATATCCCACACGCGTACTTCACCTCCAACCCCCGCGG
ACACGATGAAGCGCTGGTTGTGGCTCAAGACAAGCGCCGTGACTCCACCTGTATGAGCATTATCAATGGACCAGGCCAGGTCACCAGAGTCGCTGCTATG
AGACCGGATGCAGCCATCAGTCCAACCTGAAAGAAGCACGTCTAGCGAGTACTGGAGAGATGTCGGTGCTCCAGCATCACCAACCATGCAACGGGTTGCC
ACCGAGTAGTCGGAGGCATCCCATACTCGAATAGTGCAGTCTCGAGAGATTGTGGCGAATCGGTCGGACACGTCTGGCGCGTATGCTATCTGCACGACAG
CGCTCGAGTGGTTTTCAGACAGCAAGCCAGCCTGGAGACTTCGTTGGGAAGTGCCGAGCGCGAGACGCACGGAGTAAATCCCCCCGGCTTGGGTGCCGGC
AACAGCCTCATTCTGTGCTGCATTCAGAGCTATACCGACGACGCCGCTGTCTAGGCCAACGTGGCAGGTGTCCACGAAGTCGTGCCCGTAGTGCAAGACA
CTGCCATCCCCGCCACCTACAAGAATACCGCCATCGAAGTACAAAATGGAGTTCACGCCGCAGGAACAAGCCGGAACAACCTTGAATAGCTGCCGCGCTT
TCACGCCGACCACGCAAAAATCGCCACTCGAGCTGCCAGCAATGAGGGTCTCACGGTCAGGCGAGAACTGCACGCAGGTGTAATCACGAACGAGAGTCTG
CTCGATTTTGTGCGGCATGAGCTCACCCGTGACAGGATTGAGGACCCAAATCTGCAGCAATCGGTGCCCGACTGTAGCAAATTGGTAGTTGGCCGTGTCG
CGGCGCTTTACGTCACGCGCCATGCCCCCAAAGGCAACCGCTGTGACGATGCTCGACATCTTTTGGTGCGTGGCGCAAATGTTACCTGTCAAAACGTCCC
AAATGTACAGCCGGGGGCCGTCCTCAGGAACACCAACGGAGCATAACAGTCGCTCGTCATCCGAGAAGGCAAGTGCAGCGATACCTGCGTCGTGCTCAGA
TAGTCTAAAAGCTAGCCTCCGGGCTGAATAATCCCACACCAGGATATCTGCACGCCTGCCACGCTCACCCGAGGCTAGGATTCTCCCCGATGGAGACATG
GCAATGCAGGTCACATTACCCTCATGACCGCGCAAGAAGACCTGGCTGTGCGCGTCTTGGAAGGATGTAAGCAGCACCGAACCACCAGCGGGATACACGT
AGTCTCGGCCTGCAGGGTGATAGTGAATTGCGTTCGGTACGGCGGAGAAGCCAATGGTGTGCTCCAATTCAATCACGGGCGACTGCTGCAGCTGCTTCTC
CCGCCCTCTTGAGCTCGACTTGGTATCCATCAGAGCAGCGCCTTCGTATCCACGCATGTTGTTGCCGCCATCATACTGCATTATGACAGACGCGACTTCT
TGGAGCAATCAGCAATGAGAACTTCCCATAAGGAAGAGCCTCTAGCAACTGCCGACCGTGGAAAAGTAACCACTAAAACTAAACATATATCCCGAAGTTA
TTTACTCAAGCTGTGTCCCAGACTCGAGGAGCCCCGTGGCGCCAACATAACTCAAGCACGTGTAGTACGGAGCCAGGTCGTTCTCGTGCATCCACCGGGC
GACGTCCAGGCCAATATCCTCCTGTCGGTCGAACAGATTCACTCGCAGGACACCTCGAGCCAGAAACACTCGGGAAGGCAGCTCGAACGTTTGCATCTAC
AGTTAGCAGTGGTAAGAATTTCAGTTGTCATACCCAGCTACCGTTAGGATAGTGCGCTCGCACCTTCATGTCCTTGACAATGCTGAACACCATGGACTCG
TAGACCAAAGAGCCCATCTCTCCGTCTTCTTCCAGCTCGTACAGCGCGAACGACAACCGCTTGGGCGAGTACGTCGGGCTGCCGGGGTACCAGAACACCC
TGTACGGGACAATCTGCACACTGTTCACCATGGAGTTTTCCCACAGCGTGTAGTCGAGATAATCCGTGGTCGCGTATCCCCACGTCGAGGCACTGGCGCA
ACACAAACACCAATGAGCTTCAACAAAAGTCCCATCTTCTCGATCCATCACTCGTCTCACCTGCTCCAGTAGCACGGACGGCCTCTCGCACAGCCGCACT
CAAGCTGCAGCCTCTTGGCGATGGCTTCGAACGCCAACGGGTCGTCCACCACCACCGTATTGGCCAGCAGCGCCACACCAACGCCACAGTGCGACTTCGT
GAGCGTGTTCTCCGCCGATTCGTTCGTGTGGTCCACCGACGAGCACTCTACAAGCAACAAACAGTCTTAGATTCCCTTCCTCCTCCTCATCCTCCTCTTA
GCACCAGGCAGCACCTCGCACTTGACGCAGCAGCGAGAGATCTTCGCCCACGGGGCTCTGAGTTAGCAGCGCCAATCGCTTCCAGTCCGCAGAGCTTCTG
GTGTGGCAGCCAATCGCGTACAGCGCCATACGCCGCGCCAGGAGTTGCCATGTGTCTGTCAGACAACAGTATCCGAGTCAGAAGAAGAAGAAGCACGTTA
AAGAGCCAATTGAGCACGCACCACAGCCCACGATGGTGTCCCGCACGCGGCGGTTCACGGCCTCCAGATGCAGCAGCGACGTGTGGTCCACGAACTGCAG
TATCGCCGCCAGCATGTCGCTCGGCAGCTCGCACAGCCCCATGTGTGTAGCTTCTGGGCGACAGTTGAACTTCTCAGTGCCCGTACAATGCTAGCTCTCA
AATTGTCCGTAGGGTGATTTGGACTAAATAAATATGAACGGATATGAAAGGGTATGTTAAGAACACGTCTGAAACCTTCGCAGTGACTTTCACATCTGCC
AAGTTGAAGTTGTTGACAACATGCACAAGCTACATTTCGTGTTTTATCACTCCTTGGCTCTCTCTCTCTCTACATGTACACTTGATCAGTGAAGTCGGAC
ACATTGCTGCACGTCTAGTCGTCCCACTGATTGAGCGCCTGGCGGAGCATGCGCTGGAACTGCGATGAGGCGGCACGCTCCTTCTCGATCTCGACCCGGA
GACGCTTCATCTCGCCCACAGCGCGGTACTTCTGCAGCGGATCGTCGATTAGGCTCAGACTCGAGCCTGCAGACTTGTTCCCAAAGCTTCGCCTAATGCT
CTGCACGGAAACCTTCACGGGTGGCTGCTTCGTGACGATTCGGTCGCGCTTGGGGCGCTGGCTTGAGACGTGGAGCTGCGTCGGCAGTGGAGAGTGTACA
GCATCCAGAAGACTGGCAACGCTCGAATTGAACCCTCGCCAGTCCGCGGGGTAGTAGATGGCAAAGTCGCTCAGCGTCTCGAAGAAGGTCTCGTAGATCT
CCTCAAAGATCTTTCGCCAAGGCAACAGGACGTCCGCCTCCTCCGGAGTCACTTGATTCGCGCTTCCGTCCACGCTCTGCATCAGACGTTCATGCACCGG
GAGCAGTAAACTGTAAATCCGCTTCTTGAGTTCATACGTCGACACTGCAGTGGAGGCTGGATACGAACGGAACAGCCGATCGACGAAGTCCACGATCTTC
TTGAAGTAGACGTCGCAGAGCTGGTCGCACTGTACAGTGGAAGGCTCGATTGCGATGAAAGTCACTTCTAGCGCTGTCAAAACCGTCCTGATCTCATGCC
GCTTCTCTTGCGAGTTCCAACCGTGCGGGGGGTCCACGACAACAGACTGCAGCTCTGGTGGCGGGTACGCTAGATCCATTACGCCAGACGACAAGATGTC
TTCACGTACGCGCGGGAAAACCGCACAAATTTGGCTCTGAATACCCACTGACGATTCGTACTGGTTCATCATTGCCTTGACACTACCCTCCAGCAGCTCT
CTCAGACCAACACTCTTCAGATTATGAACGGGGGGAGACAGGGATGCAATCTTGGAAACCACTTGCCTGAACTTCTGGGGAAGAAGCTCACCAGCGTTTA
CAAACTCAACGACAATGTGGACAACTTGCGGGGCAAATTTGCTCTGCACTCGTTCGACACAGCTCTCAAGCGTACTTGTGACAAGAGAGCGCAAGGACCC
GATTTCGGACGAAGCAAACCCCAACACAAGCACACTCACGCGACACCCTGGTCTCAGTAGTGATAACAAGTCTCCCAGGCGCTGCTCCCAGCTAAAAGAA
TTGCCTGCTTGCAGCAATGTACTCAGGTCAACGGGAAGTAGGACCGCGGACGTTGCAGCGAGCTTCTCTCTCTGTACCTCACCACCGTTTCTCTGAGTAA
ACGTCGAATCAAGATACCGACAGCACACATCCACGCCCTGGTTGGACTGAAAAATGCGATGGCAGTCATGCTGGGGTGTCGTAGCATCTTGTGTTCCAGC
CTTGACCGCACACCACAAGCCAAATGACGAGGAAGCTCCATCGAGAAGATCCGCAATCACCAATTTCCACGCGATCGATGCTGCACCGGGGTTCACAAGC
CGAAGAGGAGCACAGACCAGTCCTAGGATGTCTTCGGAGCTCCAAAGTGACGATACTTCTGTGTCCGAAAGCGGTGAGTCCCCTTCCGACCTAAACGCTG
GCTTCAGTCGCTTCGTACCAATAGATACAACATTGGTCCCTCTGAACAGCCACTGCACACTGTCTTTTGCCTTTTGATGAGGTCGCACTTGCCGAAGTTT
TGCTGCATCGATGGCAACTGGGCCAGGGCCGGTACGTGAATCTTGAACGTACTTCTTCCAGAGATGCAATCTCAGTTTCAGGACGGCGAGCCTTTGCATT
TCGGCGCGACGCACCCGCTTTCTTTCGGCCCGCTCTTTCGCCAATTGCGCTTGTCGCTGCGCTTCAAGCAGTGCCTCGCGTTCCTGGCGAGCTCGTGCCT
CCGCTAGTTCTTGCTGGCGACGTCGCTCAAACTCTTCTGCAGCCTTCTGCCGAATTTCTTCTTGCCGTTTCTCTTCTTGCCGGCGTCGCTCGTCCTCGAC
AGCCTTTATCCTAAGAGCTTCCGCTCGCTGCAGTGCTTCAAGCCTTTGCTGTTCTGCCTCACGCGCAACTTCTTCGGCACGTCTGCGCTGCTCTTCGAGT
TCACGCTTCTTCTTTTGTTCCCGTAGTTGAGCTTCGAGTTCTTCTTGCTGTCGCTTTGCTTTCTCGGCCTGTTTTTTTGCTTGAGCGCGTGCAACAGCTT
CCTTTTCCGCGTGTTCTTCACTTTGAGCTGCTTTCTCCACCGCATCCTTCTTAGCTTGATCTTGGCGCACCTTTTCTTCCTTCGCTTTCTCTAGTTCTCG
CATCCGCTCCAGCATAGCTTGCTTCTTCTGTTCAAGCTCCCATTTTCTCTGCGCAATCACATCGAGATCGTGCTTTTTGTGATCGGTTTCTGCAGGCTGG
TACTGAGTATTTCCGAAGCTCACAGAGATGTTTGAAGGCGTTGGTGGAGCACTCGCTGGAGGCGCCGCTGGTGCTCCGTCATTGTAATCAACAAAATAAG
AGTAGTCGTCCTCATACGCAGGTCGATTCGGATACAGCCTTGCTTGCTCCTCTCGCTCGGAGTCTTGGATCAGCTTACTAAGCGCTGGGTATTCATCGCG
TGCGTATTCGGTCACACCGCGGCAGATATCTCGCCGAAGGTAGTTGCTGCATATATCAAAAGATTAACTACGGAGACACTTCGCAGCCACAAAACTAAAT
AATCCGTACCCTTGCTTCATTCCAACGTAAATCTTGGAACTTCGAATCTTCTGGGGTGTATTGTTCCGCCGTAGTTGCGCATCTGCACCATCGGCATCAT
ATAACCATAAGCACAAATGCCACCAATCGCAAGCCTAATAATCCATAATGTACCTGTCTCGAAATCGCCACCGAACTTCACAATCACTGCGCTGTCGTCA
CCAGTTCCAGGCCTGCCAGCTATCCTCAAGCCATGCTCTTGGCACACTGAGTAGGCGTGCTCCATGTCATCAAAGCACAGCAATTCAACCAAATCCTCTA
ATGGATAGACCTGGCTACGATAAGCCCGGTTCATACGAAGCAGAGCTGATGACCGGGCATTGGGGATGTACCGAAACAGTAAACATGACTGCAGGTAGGT
TGCTTGACGAAGCAGCGAGAAAAACTGGAAGTAATCACCCGTGTGCCGAGCAACAAACACGCGCATCGCGAACTTGATGTGTGGGCTCTCCAAGATATGA
TGCGGGAGAACCTTAACATACTTCAGCACATCCATACCGCGGCCATTGTCCAGTGCACACAGGATAAAGTACGCACGACATTCTGCCTCAAATGGACTCA
AGTACGCGGGATCTCCAACCTTGCGACTTTCATCATACAACTCGTTGAGCGACTTGAGAGTTTGGCCAAGCTGCTCCATATTCTGCTGCGCCACAAAGCT
TGGTGTCTCGATGAGTTCGTGCTCACTGAGCACGTGGTATCGCGCAATACGCTCATGGATGTCGAGAGCGATGGGGTGTACACGTCCTCCAGCGCCGCGG
TAATTCTGCAACACGAAGTCTTTTCGAATCATTCGAAACCGATCCCAACAGAAGTTATACAACTCGATCGGGCCCGGAACTCGGGGCTGCTGAAAACGTG
GATCCTCGCCACATTGGTCCAAGTCCATAATTTCCTGCTCGATGTAAAGTTGAGTGCGTCGAAGAACTCCAGGAGGGCGGATTTCCTCTGGAATATCCAG
CTTATGATCAGCTGAACTGCGTTGGAAGCGCTTGATAATCCTCTCGCGTTCAGTTCCTGGTTGGTTGGGGAAACACTTTTCGAAGACACTCAGCTCATCC
ACCCGAATGTGCAGCTCCCGTTCTGCTGGGCTACACATGTCAGCGCAAAGTCCATTCAGATTAGTAGCGGCTGAAAGTTCTGCTTTGCTGCTTTCTTCGG
TGGAGGCCGCAGAAGGCATGGGGGCGTATGAAGTGTCTTCATCGCTCGTACTCGGCGTTTTCTTCTTTGGCCGAGATTGTCGCTGCTTCCCATGCTTTTC
ATTAGTTGGGCTTACCTTAGGCGCCTTAGCAGCACCAAAAGCGTCTCCTCCAGCAGGAAAGTTTCGACTTGACTTAGACTGTTGTCCAACGAAGGGGTTA
GCATCGCGTTCTCCCGAGACACCAGCTTGTTTTCCTTTCTGGAACGGCGATTTCTTTGCGCCACTCATTCGCGCCTCCATGGAGACCATCTTGTCTGAAT
TTCCAAATCCTCCTGCGGATACGTCTGAACCAAACGTTGGCGTAGTCTGTCGTCTCTTATCGGTGACACCACCGAACGTGGTCGCAGGAGGGCTGCCAGC
AGGAGAGGGTTTCCCGAACGCAGGAGACCTAGAGCTATTACTACCCGCAGCTCCGCCAAAACTTGTATGAATAGCCGGAGCATTTGGTGCACCTCTTCCA
TTACCCGCCGTCGCAAAATGGTTGTCCGATAGCGAGGAAGATGCAGTGTTTGGGGTGATTTGCTTTTTTCGCACTCTCGCACCAGATGCTTGGCTTCCGA
AGGAAGTCCCTGGCGTCGACACTGGTGCCGGTGCTGCTGTACGACCCGACCCAAAACCATTCGAATTCTGCGAGAATGATCCCTGTCCACGCTTGGGCGT
CGGCGCCCCAAAAGTAGTCTGTCCTGCACCTGGCGATGACAATGGTGCCGGTGCTGCTGTGCCACCCGATCCGAATCCGTTCGCGTCTTGCGAAAAGGAT
CTCTGTCCGCGCCTGGGTGCCGACGCCCCAAAAGTAGTCTGTCCTGCACCGAATCCATTGTCGTTTCCTCCAAACGCTGCACTGCTTCCACCGAAAGATG
CCGATCCATTGCCACCAAACGCAGTCTTCGGTGCATTTCCACTATATCCAGTCTCTCGATTCTTGGGCTTTCCACCTGTAGACGACGAAAATCCAAACGT
CGTGTGTGCACCCGGTAACGTAGAAGAAGTCGACACGCTATTCTGTCCAAACGTAGTCCCTGCACTATTGTGTGCCTTGTTGTTGTTGTTGTTGTTGGTT
TTCTTCTGTCCAAACGGGTTTCCACCGGTCGAAGTGGCTCCAAACCCGCCCGACGGAGCTCCAGCCATTCCTCCGGGAGGAAGTGGGGGCTGATGTCCGA
AGCCTCTGCCCGGAGCCCCAGCCATTCCACCAGGAGGCAGTGGAGGTTGATTGATAAAGCCGGAGCTCTGTCCGAACGCGGTCTGGGCCACTGGAGCGTT
TGCATTGGACTGGAACTGGTTCATCGTTGAGGATCCTGGACACGCCAAGGGCACCGATCAATACCTAGAGACGCCTAGAGACGCACACACAACGAGAGCA
GAGCAAAGCGCGTAACCGTAGCCATGTAACCTCCGTACCTTGACTCTGCGCGAACGGGTTACTGCTCTGCGCCGCGAAGCCGCCGCCTCGATCTGCACAG
AGTGGACACAACGTATCAGCTTGTAACTCGGGAATCACGTGGCCAATGGAAGCGCAAGAAGGTGGAGAATAAAAACGAAAAAGTGGAGAACGCACTTCCG
GAGCTGAACATGCCGGCGTCGTCCCGAGAGCCGCTGCGTCGTCGCTCGCAGGTGTCGTCTGCGGTTCCTGGGCCCGTTGGGAAGCTGAACAGGGGGAGAT
GCAGCTGCGGTACCATGTACCGTTATGCGGTCGTGTGGCCCACCTTATCTGGAAATCCTAGTTCAGGCTAATGCGGTCTAGGTTAGGCAAGATGCTGCGA
TCTGATTGGCTGTGAGGTCAAGGCATAGTGAGCCCAAGTGAATGTCAGGACTGGAGAGCCTTGCGCGTTGGGGAACCACCAATTCTCGGGCGCTGGCTCC
GCCTGCGATTGTTGGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAACTACGCCCCATGACGGCGGCAATGACCAGCGA
CTCACACTGCGCCTTCCTCTCTCTGTGTATCGTAGTTCAAGATGGTGAAGCACAACAACGTTATCCCCAATGGCCACTTCCACAAGTACTGGGAGTCCCG
AATCAAGACTTGGTTCGACCAGGTAAGACAACAGCCATGACGAAACTTTTACAACCCCCAGCGGCTAGATGCACACACACCCCATTAGCTTCTTCAATCC
GTCTGCCACCATTGGACAAAACGTCAGAGAACGAGAACAGGTCGACTGGAAGGGGACAGACAGTGGATCTCTCTAGCGGAGACGGATTCAATGGGCGTGT
GGCGCTTTAGCTGCTGGCTGCAGACAACTACGAAGGATCTACGTACTGATACAAGTGACATTATGTTGTGACCTACCAATAGGCTGCCAAGAAGAAAACC
CGCCGTCTGGCACGTAAGGCCAAGGCTGCTGCCATTGCCCCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCACTGCCCCACGATCAAGTACGGCT
CCAAGGTCCGTGCTGGCAAGGGTTTCACGCTGGAGGAGCTGAAGGAGGCTGGCATCAACCGCAAGCAGGCCATCAGCATCGGCATTGCCGTGGACTTCCG
TCGCACGAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCGTGAACAAG
CCCAAGAACGGCGACTCGTCCCCGGAGGAGACCAAGAACGCCGTGCAGTACACGGGCGCGATCCTCCCGATCACCCGCTCGAGCGTCAAGTCGACGACGG
CTGTCATCACGCCCGAGATGAAGGAGAAGAGCGTCTTCACGCAGCTGCGTGTGGCTCGCGCCGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTGGC
TGACAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACACGTGCTGGCTTGCTCTCTCAGCCGACTTGCTGTTGAGAGGGTGGGCAACTCCCTAAGGTC
TTTTGCGGAACGTTGGAACACAATATATCGCGCATCAAAAAAGCTCGGTCTTCTTTTTTGCATATTTGTGTTTGAGGCTTCGTGTTGCAGTTTAAAGGCA
ATATCGTTTAGACTTGGTATTTGACCACCTAAATCTACGTGTTCACACTCTTACGTCGGCATACGCCTCTGGTTCCGACAGTAATGGTTGTTGCTCTGGT
TCGTCGGACAGCATGATGGACTTGTACTTCACTGGTCTTCCCACCAAACTGTTGTTTTCTGAGGTGTCAACCTTCTCGGGCAGCACGCAAAGGAACACCA
AGACGAGCAACTGGCCGACAGACGCAATCACCACGACCAGCCACAGATGGCTCCAGTCCACAACCTTTGTGGTCGGGTCGGGAACAATTCCGAGTGCCAA
CACCAGTAGTGACGTAAGAACTCCCGACACAACGCCGCCGAAGTCCATGAACGATAGGTACAATGCGTACGTCAAACCTTGAACGTCCGAGTTTGAAGGG
CAGTAGTACGTGGCTACTACTAGCAACTGCAACAGCGCGAACTCCGAGGTGAACGAGGTGATAAAAGACTCCACTGTGCCAAACGTACACACTGAGACGG
GAAGCTGCACGACAGGTGGAGCTAGCAACAGTCGTGGCAGACCAGCAGCAACAGAGCACACTGTAGAGAGCAAAAAGACGCTTCGAACACTCCGGTTGGT
GCACCACTTGGCGTACGACAGACACGACAGGAAGCGCCCGACCATGCCAGCGAGGTACATGTACTGCAAGCACTCGTGCTCGTCTTCAAGGAGCGAGAAC
GTGTACTGGTACCATATCGTTCCATCGCCAGGCAGTGCATTGCACAAGAAGAAGAAGAGCATGGGCGGCAGCACCGGTCGCATGAGTTCCCATTTGTGCT
GAAGTTCGCGCTTAAACGGCAGCCACCACGAGTTCAGCAAACTTGTCGATGCAACAAATTCAACAGGTTCCGATTCTCTGTCGTCGTGTAGCTCATCCAC
GGGTGTCTCCTTCAATCCAACGAGACACACTCCCGCCGCTGCTAGCGGCAGCATACTGGTCCATCCAATAACCTGCTGCGGCGTGATGCTCTTGTCTCGA
TACACTGGGATGCCCAGCACCAAGGCTGCAATCGACGCCACGTTCTTGACGCCATTGGCCAATGACTGCACGTGTGCACTGCTTCTACTGGAGGCATCTC
CCGTCGTCAGGTCCACCAACAAGACGCCGAGCATAATCTGCGCGAAGGCTTCGGCCACGGCGTCTACGAGCTTCACAGCGAAAGCGCCAGCGATCGAGTG
CACGTACGTGGCCGTCAGCACCAATGAGACTGCGGTAACGACCTCGCACAGAACGATGTACGACTTGCGGTGGTACCCGAAAAGCGGGAGGCTGTCGGAC
AGCAGGCCGTACAGCGGCTTGAGGTTCCAGGGGAAGAACGTGACCGAGTAGTAGAGCGTCGTGGTGGCTGGCGGCATGTGAATGACATCGAAGAGCCACA
TGCCGTACGCTGTCATGGGGAACGACATGATGAACGAGTGCAGGAAGTAGAGCGCCAGCAGCGCCACCGGCACTCGCGTCATGGCCTCTCTTCCAGTCTC
AGCATCTGATACGCATGGCTTCAAGCGGCACTGTAAACGACACAATAACAATCATGTTGTATCCAACAGTAATTTCTGGCGTTTGATTGGTGTGGACGAA
TAAACGTATTTGATTCGTTGAAATACAATGCCATGCAAACTGTTGTCATTGGCAGAAAACCATTACTGCCACGAGCACCAACGCACTAGACTATCGCCTG
GCGGAGGACGCTCGAAGATGGCGCGCGACGAGTTCAACATCGACGAGGCCGATGACTTCGACGACGGCACGCGAGCGGTGGTGCACGCGGATGCGGCGTC
GGATTCCGATGCAGAGGTGCAGGATGCAACGCGGCTGCGCTCGTCCCGCAAACAGCGACTGCAGGCAGAGCGCAAAGGAGGCAAGCAGCGCGAGAAGGCG
TCGGCTCTGCGCGTCAAGAACTGGGACGCGCTGGAGAGCGCCGAGTACGCGGGCAAAGTGGTGAAGCGCAAGGAACTAACGGAGGATGGACTGGAGTCAC
CAGACGAAGATGCAATGGCCGAGTGGTCCGATGCTGAGCCGTTCGGAACGTCGGAAGATGAAGAAGAAGAGGTCGAAGAAGAGGAGGTTGAAGAAGAAGA
AGAAGAAGAGAGCGAAGGAGATGAAGAGGACAAGAGCGCGGAGATGCTCATCCGCGGCTTCCAGAAGGAGGATTCGGCACGGCTCATGAGCGCGCAGGAC
AGCGAGAAGGTCGTGGAGAAGGCGCAGCACGTGAGGAACCAGAAGATCATCTGGGAGCGCTGTTTGGAAGTACAGATCTACGCCAAGCGTCTGCTGACAA
CGGCAAAGGATGTAACGGCACATGAGACGGACGGAGAGACGACGGATGAGGAAGCAGCTACGAAGACTAAGGAGGAGGTGGTTGCTCAGCTGTACAAGAG
CATCGACGCCGTGTCTGCACTGCAGGAGAAACTGTGCAATGTACCTGAGCTGAGTGCGGGTGACGCACCCACCAAGAAACGCAAGCGCACGTGCGATGAC
TTATGGCAGGAGATCAATGCTAACAACCGCACGATCCTTCCTCAGTACAACGAGATTCTCAACACATACACGCGCAAGACCGACCTAGCGGCAGGAGGCA
AGAACAGCCAGGCGAAGAAGTTCAAGGCTGTGAACCAAGATATCCTTGCGCAAGTAGAGTCGGTGCTCGTGGATCCCCAGCGAGTCAAGCGAAAGGCACA
TGCGCCGCTTGATGTACCAGAGGACGAGGCCACAGACGGAGCTCAAGACCTGCTGGATGAGCTCATGTACGACGACTCTGATTTTTACCAGCAGCTTCTG
AAGGAGTTTATCGAGAGTGGTGGAGGTGGCGCTGGGCAGGACGCCATGGTGAGGCGCACTCACCGCAAGAAAAAGAAAATCGTGAACCGCAAGGCGAGCA
AGGGCCGCCAATTGCGCTACACGGTGCACCCCAAGCTCGAGAACTTTATGTTCCCGGAGCCTTACCCCAAGCCGGAGATGGACGTGGACGAGCTTTTCCG
CTCGCTCTTCGGCCAGGTTCGGCAGTAGAAAGCTTGACATTGACATGCTGGCCATCGAGAAATAGATTGATTTTGATCGGAATGTGGGTGCTTGTAGGCG
TGTTAGTGTTTCCTACGTACTTACCGCGGTAAATACCCTTCTGCCTACGCCATACGCCGGCGCGCTGCGTCTTGTTCAAGGAAGACATCGCATGTTTCCT
TATAGCACATCGTCTTCTTCTTCCTCTTCCTTTTCGCCTGATAAGTACACTTCCTTGACCTTCGCTACGGTTGCCTCCAAATCCCGGAGACGCAGTTCAT
TGACTCCGCTGGCGCCAATCTTCTTGACGATGCCCACCAACGTGGCTGCCTTCTCAGCGACGTGCACCACAGCCAATGCTCGGATCTTCTTAGCTCGAGT
AGCATTCTCCAACGACCGGAATTCCTCATCGGCTAAATCCATCGACGCATCAGCAAGCACTATTGTGGAGTCAAGGAGCGCAGTGCCATGCTCCTCAAAG
CGCTCAGGGATGTTGAGCTCGTGCAGTTGCCGTACTTCCGAGGCATACGAGCCGCTCTTAAATACTTTGTGTTTGAGTTTCACTGTGTCCTTCAGCAGCT
GTGTGAACTTGTCGATCAGTTCTGGCTTACCCTTGGCGATTGCACGCATTGTTGCAGGAGCGTTTAGAATCTGTGCGCGCTTTGCGATCAACTGGCCAGC
ATCGCGTTCCAGGAACGAAAGCCCCCACAGACGTCCGTACGCCTTGCCAGCATCTAACCGCTCCTGTTCTGAGTAGTACCAGTCCCGCGTTTCCTTGTTC
TTGATGAGCAGACGCGATGACCAGGACTGGACGGAGTCAGTTCCGAGCGCAAGCCCATATTCCTCCAACTTCGGAGCGATTGCTTTGTAGAAGGTGATCG
CTACTTCGTCGGTGGACAGCTTCGTAGTCAGTAGTTCCGCAACCAAGCGGTTGACTTCCTCTCGATTGTCAACGAGCTTTTTGTTGCTCTCCTTTCGCGC
TTTCTTCTCGAGCTGCTCGATCATACTCATACCAACGGGTCCCTTTGATTGCTGGGATTCATCACCAAAGATGTCGTCGATAGCACTTTCCGCGGCGGCC
AGCTCCTGCGCCATCTGATCCTCTACTGACCGCGGTGGCATGCCATCTATTGTAGCACCACCGCTGCTCCCGCGACCACGCGCACCGTTCGCCAAGCCAC
CACCATTTGACACTGTATTGATCCCGTGAACACACGCACACATCAGTATGCAAGCAAACGACAACAACGCACCTAACAGCCAACTTACCTTGTTGGATAA
TCTGCTGGTGTTGCATTAGAATACTGAAGAGCTGCTCCATTGAGACAGGGCCAGTTGGTGAGGCTGGCGCTTGAGCAGGCGGCTGATAATGCAAGCACGA
TTTAGAACTACGTAAACATTGACAAGACAAACAAGAAAGCTGTACCAAAGTAGGTCACTTACACCAGGGTCGTTGGGAGAAACGGCATCTGGACGGTCAA
GTAGATCGGGATCCATCTCGTCCGCCTTCATTTTGAGCTTGATCTGCTCGTCAGGCATGCCCATTTGCCGCAGTTTGAAGTACTTCTTGAGCTGTGGATC
ATCTTTTACAAGAAGTGGTTCGTACGGGACAACAGGCGCTGGAGCAGACATTGAGGGCCAGCTGAAGCCGCCACTAGATCCTTGGGGTGGAGACAGCGGT
GCCATTCCATTCGACGGATATCCTGACGAGATTTGCAACGGTGGCTGCAAGAACAGAAAACATAGCCAAAACGGTCAGATAACACATGCTTGATGCTTCA
CAACAGTGGACAAACTCACGCCAAGGTCGTTCGGTGACACTTGATTCGGGTTGTCCAGCAACTTGGGGTCCACGCCGTCGGCCTCCATTTTTATCTTGAT
CTGACCCATGGGCATGTCCATACTCTTCAACTTGAAGTACTTCTTGAATGCAGGATCGTCCGCCACGGTCATCGGGATGTAAGCACCCTTCTCTGGCTGT
AAAAATAATAAATAAACACCAGACCCTGCATAAGTCCTCGTGCCAACAAGACAACCTCGTTTTGTACGTACGCCCGGGTCGTTCGGCGACACAGCGTCGG
GTGTATCCAACAGTGACGGATTGACGCCGTCCGCCTCCATCTTCGTCTTGATCTGATCCACCGGCATGTCCATTCCCTTGAGCTTGAAGTACTTGGCAAA
GTCGGGGTCGTCCTTCACCAGCAGTGCAGTGTACACACTCCTCGCGCCTCCTGCGTACGTCTGCGTCTTCTTCTCCAGCTCGTTGAGCTTTTCGTGCAGC
GCCTTGATCTCCTTCAAGCTGGCGCCGGACGCTCCTCTCTCTCTGCTCACTGCTCCGTTCTTCTTGTCGGCCATGAGCTGGGAGATCTGTCTCTGTAGCT
TGTCAATGGACGAGCTGGTCGTCACGACGTCCGCTTTGGACGCCAGCTCCAGCAGCTTCTTGACCTGCTGGGGCGTGAGGCCAGGGACTCCCATGGTCGC
GAGCGGAGCGTGGGCCACGTCTTCGCTCTCAGAGTCGCTCTCCTCCTCCTCCTCGTCCGACTCGTCCTCTTCCTCCTCATTGGCTGCCTCCTTCTCCATG
CGCCGCTTGATGCAGAGGTTGCGGTGCGCTCTCGCATGTCTTCTCTTGCATGTCTAGTCATATTCCACATAGTCATATTCCATCCTCAGTTAGTGATAAT
CCACCGTTTCTTAGTCGGAATATATGCTGACGTACTTCGCTGCAGTAGGACGCTTCGTTGCAGATGGTGCAGGGTAGCGACGCGTTGGGCGTCGCACAGT
AGGCGCAGTCCTCGCCCGCCGACACCGCGAAGCCGCCTGCCAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATGGCGAGTGATTGACGCGA
GGCTTCTTGAGGACTGCTGCTTTTAGAAACACCAGAAACGGGTCTGATGGGTTTGATGTCTCGGGACCCGAAACTTTGGCTGATTGTCCACAAGTAGAAC
GTGCCTCGGCCATCCTCTCATCAACAGGAATCCAGTTGATCCAGTCTTCTGGATAGCCGCAGATGGAGTGAAGCCTACCAGAATCAGATCGATTGGAATT
CGTCACTTCAACTTGCCTTTTGCCAAATCTTGTGAAAAGAGTGTCATGTGTATTGCTCTGCTACAATATGAATAAATAGTGCGGCGTGCGGCCATGCCAC
TACGCTCTTCGACCGAGCGTAGTTGGCCGCGTGCGGCTTATATAGATAGGGTTTGCCTTGAAAGGAGAGCTGCGTGTCGTCCTCCTCTAGGCTGCAGCTC
GGGACAGGCGACGCTGCGAGAGCATGCGCACCATGTCCGAAGACTTGTCGGTCTCGCTAATGTTGAGCACGTAGTCTGATCCCACTTGCTCGTTGGTGAC
AAAGCCCGAGAACCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCCGCGATCATCATGGCGTCGCTGTCGTTCTTGGTGCGCTTCTCGGGG
TCGGCGTCGTGGCGCAGCAGAAACTCGGAGATCGCCAACGAGCCCAGTTTGGCCGCAAAGTGCAGCGGGGTGATGCCACTCGCTGTCATGACATTCACGT
TCGCGCCGTGCTCGACGAGCAGCGAGACGATCTCGATGTTCTGCGAGACAATGGCGGCATGAAGAGGGTAAGTGCCGCGCTTGCTGCAAGCGGATACCTT
GGCACCAGCCTCCAGTAGCAGCTTCACGACGTCGACGCATCCGTTGCGGCACGCTGCGATGAGCGGGGTCACACCAGCATCGTTCGCCTTGTTGACGTCT
GCGCCCTCGTCCAGCAACAGAGACACAACGTCTGTGCGTCCCATGCGGGCCGCGATGTGCAGACACGAAGACCCATCGGCCATGGCCGTGTTGGCGTCGG
CGTAATTGAACAAGATGAGCTGCACGGCGTACAAGTGGCCGATACGGCACGCCACATACAGACAAAGCTCCCAGCGGCGAGCCTGGGTGAGCTCGGGTGA
GCGCAACTCCTCGATGTCGTTGGCGAACTGGTTCAGTACGTGCTCGCAGAACTCCTCCATGAACGAGTGCATGGTGTGGACGCGCACGGCCTTCACTTGC
AGGGACGGGAGCGTCATGCGGTCAGGTTCTACGTCGTTCTCTTCACTTGACGTAGGCGTCGAGTCCTCTTCCATTCGAGGCTCGACAGCGCGTGGAGCAC
CAAGATGCACCTCACTTAGCTCAGGAACGCCTTCCTCTTCTTCATCTTGGCTAAGCATCTGCTCGGCGCATTGCTGCCTCCACCCGTTCAAGGCGAGCGG
GCGGTGCAGCGCCGCCGAGGCGTCGGTGGGGAAGTGCTCATTGGCGCCCAGGAAGTTGGCATACGTCTTGAGCACGAAACAGCTGCCGTCCTGCAGCTTG
TCCCGCAATGTGGCACTGGTGAAGGTGCCAAAGAAGTCGTGTAAAAGCGTCACGAAGGCCGCGAACGCATCACGGCGCTCATTAACGACGGCATGGTCGA
GTCCCGAGAGCTTGGAGCGCAGTGAGCAGCGCGACGGGAACGGGAACGACCGCAGCAGCGGGTACAGGCCGTCAAACTCGCAGTGGTCCTTGGCGCAATG
GCATTTGTGCGCGAGGCTGAGCGTCAGGTGGTGGCGGTGCTTCGGCTCGTTCACACGCTCCCGCAGCGTCTTCCACAGACGGCGGAACTGTGAGTACGAG
CGTAGCGTGGTGCACACGCCGTTGGCATCTCGCTTGGTGAGCTTGAGTGCGAAGAAGACTTTGCCGTCCGTGACCTGGTAGGAGGGCACGGCCACGTCGT
ACTTGTGGACCCAGCTCATGTGTTTGTCGAAGGTGGTGTCTTGGCGAGTGGCTGCGACGGAATTGGCGACAGGGTTGCTGGCTTCTAAAGGTGTTCGGAT
GGTTCTCGGTGCGCCGGTCTTTCGAGATACGACCGAGCTAGTAATAGCGAGGGCCGGAAATAGAGTCCCGAGGGGATTCGCTGGGTTGGTACGAGCTCGC
TGCAAGCAGCAGAGCTACGTGGATCCTTTTCCGCGTTGGAAAAATGGGAATTGGTCCAGTGCCGGACAAGCGCCAAGATGCGGCGTGAACTCGACAAGCA
TCGTCGTTGATGAAAGTCACACGCGGTCTGATCTACCAATGGGCGCGCGTCAAATCCCCTATTTTGGCCAATGGCCATGCGGTCCCCCCTTTCACAACCG
AACGCAGAAAATACGCGTGTTTCTGCCCCGGCATTAGCTTGGCTGGCATTCATCCACGCTTGACGATTTGCACCGTCGGCGCGGTCTCCGATGTTACTGC
GCGTCACCAACACTGGTGCGAGCTGACCAGGCCGCCGCAGTCTGCATGGAACGACGTGTGCAATGCAGAACACAATTCCCACTGCAATCTTCCGTGTCAC
TTCCCATTGCTGCACGCAGCCCACAGCCCTGGGGAACGTACACCGTGAAGTTTGGGGACGTTACCAATTCGGGGGAGCACAGCTAAGAATTGTCAAATGC
TCGTTGCGATCGCGACAGCCGATGGATTTTCGCAGCGTCCCCAGCTCGTGGGCTTTGTGCACGTGGGGTCAGCAGGGTTGAGCCCCCACTGGTCAGCAAA
GTTGAAGCGAGCAGCATCAGCGAGATCCGTCCGGTGCACCATGCAGAGCTCCGAGGCCGTGAACTGGGCCTGCAGTAGTTGCAGTGCCTCAACATCCAAG
GCAGTGCTGGTGATGCGAGCCCCCCGGGTGATCGCAATTGTAGCCCCACCGCTAACGACATTCAATTCCTTAGCGGTGGATTTTCATGAGCACCATCCGA
GCGTTCGATCGTCCGTGCGACTTGTAAAAAATTCGTATTGCCGCAGACGAACGGCAGTGTCGTGTTTGTGCTTGCAGAGGATTCCGACACAACGTAAAGG
CAGGCTTTGCACGGACACTTGGTCGACGTACATGTACAAGCGACTCCACCTACAGGGTATCCTTGAAGCGGAGGTGTTAGCCAATGCAGTGATGCTGTAG
AGTTACAATCAAAACGGCGGACCAAAAGAGCGGTTTACAATCAAAGTCGCTCGAATGACCTTCTCCATGTAGCTCTTGTGTTTCACCAGGAAATGAGAGA
GGGGCGAATCCTAGCTTTGGCGCACAATCGGTATTGAACTTCACCTTCAATTCGGAGAACTCTTGTCATAGCTCCAGTTGAAGTTCGCAGCAGTTGGCAA
CTTGAGCTGCTTCAAGCTTTCGCTGCCTTCAAGAAGTCTTGCCATAAGTTGCTCGCTCGGCTTAACTGCTTCCTGTATTGTGGCTTCTGCTCCATCGTGC
TGGTGACTTCGAGCTCACAAGTGCCAAGCTACTGGTCGCGTCTCTTCAAACATTCGAGATCCCTCATGGGAAGATTGGTAGCTGCGGTATGCTGCGCCAT
TGCTACGACTGCCGTGATCCACACAACCGAGGCGCTCGCTTGCAATGCTGGCACGTATTTTGACGGCACCAAGTGTTCGCGATGCCCCGGAGGCACCTTC
GGCTCCACACCAGGACTCACTTCATCGTCGTGCTCCGGACAGTGTACGGGTGGGTTCGTTTGCCCCGAGGGGTCGACCTCACCACGAGAAAAGCCTTGCG
GCACCTCCACCTACTACTGCCCCGCAGGGAGTGGGGAGCGTCGGAGGGTAGACACGGGATACTACACAATCACGTTTCCAACCGATCAATACAGCTCGAA
AAGTGGTGCAGGACAGCAAATACGCTGCGAGAAGGGATACTACTGCGTCTTCGGGATCCGCCGAGCCTGTCCTGCTGGGGTGTTTGGTGAATCCACGAGA
CTCACAACCCCAGCATGCTCTGCTCCGTGTCTGATGGGGTCGTACTGCCCCGAGGCAACATCCGTGCCGATCCCATGTCCCGCTGGAACCTATGGGGGTG
AACTTGGTCTAACCAATGCTCGATGCAGCGGACTCTGCCCAATCGGGCACTACTGGTACGTTTTTCAACTTGCAGCGTGTTGATACACTGATATTTACTG
ATTACTTTGCTTGGAACAGTGAGAAGGGGACAATCGTTCCGGTCGCTTGCCCTATTGGGATCTATGGAGCTACACAGGGTCTCATGACTCAAGCATGCTC
GAGTACATGTTCTCCAGTCAATGGTGTGCTTTCGTGCCTTCCTTCACCATGCCCACCAGGGTTTTACTGCCCGCTTGCGGCAACAGTGCCCTTGGAATGT
GGAGCAGTGAGTCAGTTTTGCCCCAAAGGCTCTCCACTGCCAACCACTGCAACTCCAGGATACTACACGACCTGGAAGGCGTACTGGGGGACGACCGCGA
CAGGAGAGCAACTAGCCCTGCAGTATGTTGAAGGCAGCCAACTTGCCGTTCGGAACCAAACCACTCGATCAGATCAGCACATTTGCGAAAAGGGGTCATT
CTGCATTGGTGGCGTCAAAAGGCTTTGTCCTGCTGGAACTTACGGTGACAGCGAAGGTTTGCCGACTGCAACTTGCACCGCGCCATGCCCTGCTGGCTAC
TTTTGGTAGGGACGTCAACGTCCCCGCATTCTTTCATATCGTCGTGGTCTAACGGATCTTCCCGTGTTTACTTTCAGTCCGGTAGGAACGGCAAACTACA
AACTGCAGCCGTGTACGTCGCGGGCATCATTTTGCCGCCAAGGCTCGTCAGTTCCCATTGCTGTCGCCACTGGGTACTTCACAGTCGCAACACAAGCAGG
GCTTCGACCAGACGAAACAAAATGCCCAGCTGGAAGCTATTGCACCGCTGGTGTTCAATATCTGTGTCCTGAAGGCACTTACGGAGCCACGCCCGGTCTC
GCGACCAAGACGTGCACGGGCAAATGCCAGGATGGATACGTCTGTCCACGTGGGTCAACGTCAGCGATGCAATCACCTTGCCCGGCAGGATCGTACTCGC
GAAATGGCAAAGTCTGTGCAGCCTGCTCTCCTGGGTACTGGTGCGGTGTTGCATCTCCGGACCCCCAGCAACACGCCTGTGGAGCTGACAATACGTTCTG
TCCTCTGGGGTCGCCAGCTGCCCAACTGGTGCTTGATGGCTATTACGCTGTGGGACAGCAACTTAGTACACACGCGTCGGAGGCGTTGTGTGTACTTCGC
GATGCCCCCCATCTTCCACAGTGTCCTACAAGAACTATAGGAGTGAACGGTAACCTTTAAC