Description :
From Genome Similarity Track
Location :
contig_30:231962- 284420
Transcript NameFunction/comments
g6261.t1hypothetical protein
g6262.t1XP_009538867.1 hypothetical protein PHYSODRAFT_533148, partial [Phytophthora sojae
g6263.t1hypothetical protein
g6264.t1OWZ14622.1 hypothetical protein PHMEG_00011874 [Phytophthora megakarya
g6265.t1hypothetical protein
g6266.t1hypothetical protein
g6267.t1RAW42882.1 hypothetical protein PC110_g985 [Phytophthora cactorum
g6268.t1XP_009538857.1 hypothetical protein PHYSODRAFT_532549 [Phytophthora sojae
g6269.t1hypothetical protein
g6270.t1hypothetical protein
g6271.t1hypothetical protein
g6272.t1ETP36559.1 hypothetical protein F442_15538 [Phytophthora parasitica P10297
g6273.t1POM58883.1 Traub family protein [Phytophthora palmivora var. palmivora
g6274.t1hypothetical protein

Sequence
52458 bases(100 bases per row)
ACTCTTACATCCTTATCAACACCTAACTTACATTTAGAATCGCATCAAGCTGTAGACTGCCACCTTGAGATGACTGAGGGACCCACAACAACAATGAACC
ACCTCCTGTGCCAGGAAGCCCCAAAAAACCCGGACGCCACCGATCCAGATACAACGTTTTACCTCCCAAAGCCGTAACATTCGAGACCCAGGTTGCAGTT
TCACCGGCTCGGACATCAACTTCATCGATTTTGTTGCCGCCAGATATGATGTTGACAGTCACGTCCTTCGTATCTTCACTCTTGAAGTTAATATTCACAC
TTCCATCGCCAACTTTCGTCCACGTGCCGTCGCTGTTGTTGAAAGCACCCTGAACCATTTTCAGTGCTAGCGCTTTTTCCGCACTACCATCGTCGACCTC
GCCAATGAGCTGAGTAGGACCACATATTGGCTGGAAGTACTCGGAAAACGATCCAGCGACAGACCAATCGTCCCAAATCGCGTACATTCCAAGAGCCTTG
TCAGCGATTTTGAAAGCATACTCGCCAGCATGGAGAAAACTCCCGTTGCTGCTCGTTCCCGAACTGATGAGATCGTCCACAACACTCGCAAACGTTTTGC
GAAGAGTGTCACGTGTGGCGTACGCCGTCTTCTCGTCCGATTCCTCGATCAGCTCCCCCATGCAGTTATTAGTTGCGATAGGAATGTCGTTGAGCACCAA
GTTCGACTTGCTCATAGCTACACGAATATCATCTTCGGACATTTCCGGATTCTGTTTTCGATATTCAGCCACAGTCATCCATGTGCGATCCAGCAAGCGC
TTCATGTCGTAGCCACACGTGGAGTTGGATTCCATCGCTGATTCCAAAGAAGTAATGTCACTTTTGCTCAGCGAGCTGAGGGTCTCGCCTAGCGTGATAT
TCTTCATGAACGATGTGAACTTGCCCCAACTGGAGATGATGGTGGCGCCGTTAGCTATCACTTCTTTCAGAACGTACTCAGCAGTCATCATCACACTGTC
GACGAACTTGACGTCATCCGACACGGAGTTTCCAATGCAATAGGCGACCGCGATTGGGATATCAATAACGACATTGTCCGTTTGGTACAACATCGTCAAT
ATCTTGTCTTGCGAGGTTTGAGGGTCTGAGACTTGGAGAGCACGAACATATTTCGCCAAAGACTTTATCAAACCCATCGTGTACTTGGCGCACTTAATTG
CGACTTGCACAGCCCTTGCCAACACCGCGAACTTGCCGAACACATCGTACGAAATGAGAGATAGCGTTGTCTGAGCTAAGGCCGTAACCTTGGTGACGAT
TTCGAGCGCGCAGTCGTCGTTCTGTCGGATGCATTCCATGCCGCATTCCACAGGGTACGCGTATGGACACTGAGCCCAACAAGTTCCTAGCTTGCCTTCG
AATCCAAGCGGGCAAGTCTTCGCAATGTGGGCTTCTCGGTAGCACGCGTTGGCGATTGAAGTATCGAGAGCAGAACCGACCCAATTCGCGTAGGTAGACT
TGATCGTGCTGGTTGCTTTGATCACGCCGCCCATGGTGAGTGCAGCGTTCATGGTCCTGGAGATCAGTTCTGACTCTGCAGCTGCGTCGCTGACCCTGTC
CGTAGCCTCGTCCTGTGTGGAATCCCTGTCACTGCGGTCAGACTTACTCGAAAGCGCAGTGTGTGCGATGCTATCTATCGAGTCGCTGTCCTCACTGTCG
GTCGAATCGCTGTCTTCACTGTCCAATGAATCAAAAGAGTCATCGTCGCTCCTTGATAGCCCAAACGAAGACACAGTCGCTTCCGGCGTCCCAATCGTTG
CTAAGGTGTCCGACGCGGCCACAGTAACGAGAGGTGTCGGCGTTGGTGCTGAGTCAACAACTTTACTGAACGCGAATGCCTTTGCCGGAACCTGTGTGGA
CTCGCCCCTGATTGCTGCGACGGCGACGAACATCACCATTGCCCTGAGTATCATGTTTGGGCACTCACGCGCGCCAAAGAGATCGCCGGGCGGCGTTTGT
CTCGAACACAGCAAAATGGGAAGTGAGCTGTTCGATTAGCGAGCCCGCTCTTCGAGCCGTGTCTCTTTTACGGGCACCGGCCGCGAGAATCGTGTTCATC
TCTGATGAAAGTCCTTCGCTGTGGGGGAATCACTATGGCTGTACGATTCCTACCGCAGGAAACCCTAGCTTTAAAAAAGTCAAATCTTCAAAATAGTCGC
AGGGCAGATCATCGGAAACCGGTTTGACACGGCGTTCAGTATATTGAACACGGCTTTCCCGCGCAGCCATCTGGCCGACTCAAAATATCGCCGAGTCGTA
CGAGAGGGCTTGTCTCCGCCATTCGCTTGGTCGGATCGAATCTCCACTCTGCGAGAGAAACAGCATCTTGTGGCGTCGGGATAGGGACAAGGATAGGATG
GAAATTCAGCCTGTTCTCAACAATCGAGAGGCACCGCCCCGTGTTGCACAGTAAATTTTACGGACTGCATTCTGCAGCTCGAGACAACGCATGAACAGTG
GTGATGTGAGTTGCTCAAGATTTTTGATAGGTGTGCGTCAAAGTCATTTGACTAATCAGCCTGAGTCAGCCAAGTGTGGAATGGGTCTTTACGTAGCATC
ATTTGTGCTGGAATCACTCCGCTGGCGGCTCTCTGAGTCAGCTCAGGCAAATTTAATTTGTATCTTTGGCTGGTGACTCCGTCTTAGTAAAAATTGAGGC
TCTACAGCCCTATAAACAAAACTTAGCTTACATTGAGTATCACGTTGAGCTGCAACATGCCGCCTTGGGTAGACCGAGGGACCCAAAGCAATAATGAGCC
GCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCGCAGTCACGTTCGACGTCCACGTCACGGTC
TCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGTATCGACGCTCTTGAACGTGATGGTTACAG
TGCCGTCTCCAACCCTCGTCCACATTCCGTCACTGCTGTTAAAAGCGCCTTGAACGATCTTCATGCCGAGGGCTTTCATCGCGGTACCGTCGTCAATTTC
ACCGATGAGCTCTGTAGGACCGCAAATGGGCTGGAAATACTCGGAAACAACTGTGGATACGTACCACGGATCCCAAATTGCGTAGAATCCCATGGCTCTA
TCTGCAACTTTGAAAGCGTACTTCTCGGCAGTCAGAAATGTGCCATTGTTGCTCGTTCCCGAGCTGATGAGATCGTCCACAACACTCGCAAATGTTTTGC
GAAGCGTGTCACGTGTTGCGTAGGCGGTTGCCTCGTCGGATTCTGCGATCAGCTCGCCCATGCAGTTGTTTGTCGCAATGGGGATATCGTTCAGCACAAG
GTTCGACTGGCTCATGATCGCTCGAATGTCGTCTTCGGAGATATCCGGGTTTCGTCTGCGCAGCTCTGCCACGGTCATCCATGTGCGATCCAGCAAGCGC
GTCATGTCGTATCCGCAAGTTGAATTCGACTCCAGCGCCGTTTTCATATTCGTAATGTCGGTCTGCTCGAGAGAAGCAATCGAATCTCCAAAGGTAATAT
TCTTCATGAAGGCCGCGAACTTGTCCCAACTTGAAACGATGGCCGCTCCATTGTATAGGACTTCCCTCAAAGCGTACTCTGCAGTCATCAATACACTATC
TGCAAACTTGACATTATCGGATGCCTTTTTCCCGATGCAATAGGAAATTGCCACAGGGATGTCGATAATGACATTGTCAATCTGATAAAGAATCGCGAGG
ATCTTGTCTTGCGAGGCTTGCGGGTCATGAACTTTGATATAGCGAATGTACTTGACTACGACTTCGTGAGGCTGATCATGTACTTGGTGCACTTGATAGC
GAGTTGAATCTTCTTTGGCCACTTGGTCATGTCGCCGTACATTCCCCATGAAGCCAGCGACAGCGCCGTTTGAACTACGACTGCAATCTTACCGAAAATT
GCGAGCCCACAGTCGTCGTTCTGCCGGATGCATTCCATACCGCACTCGATAGGGTACGAGTACGGGCACTGCGCCCAGCACGTCCCCAGTTTGCTCTCGA
AACCGAGCGGACACGTCTTGGCGATGCGAGCTTTGCGCCAACAAGCAGAAGAAGACAACGTGTCGAATGCAGAGCCAACCCAGTTGACATAAGTAGGTTC
AATCGTGCTAGTGGCATTCAGCACACTACCAAGCTTGAACGCCGCCATCCATGCTGCGGTTGGCGCTGCGGCGGACTCCATCTGTGAAGATGCAGTGTCG
TCGCTTTCCGCATCGTCACTGTCTTCAAAACTGTCGGCATCTCGATCGTAGGCTCTAGCTTCCAGCTTGACGGACAGCGCTGTCTGGCGAGACTGTCCGT
GAAGTCTTCGACGCTGTCTTTTAAGTCATCTTCAGTCAGGTTGAATGGATTCACAGCCGTGGCTTTCCCCGTCGCCGATTCATGATCTCCAGCGACCACC
GTAGCTAGGGACATCGGCATCGATGAATCGCGCTCGTCAAACGTGTATGCCTCGAGCAAGCGAATCCCGTTGAGCATCACTGAGAAGGCGGCGAGAAACA
ACGCAATCCTGACCATGGAGTCTAAGCAAGAAACGTTCTTGAGCGAGTATGGCAAAATGAAGACTGAGATGGCAGTGAGGAACGCTTCACTGACGCATCG
GAGTTACGAGTCCCAGGTTCTTGAGGCTCTCCTACTTGGCGGTCGTTCACGGATACCTTTGTCTGCCGCCGGATTAACGACCGCAATGTTCAAAGCCAAG
GCGATCTGGCCATCGAGAGGCGCTGCTTCCAATCCAGAGTATTATTATTCGTCGGTAGGATTACCAAATGTCGTGCTTTTGAAGGGTGCGTGTGTCCTGC
GCCAGTCACTTGTCGGTCACCGTTTGAGACGTACAACCACCAGGATACGAACAGGGATTAGCACGCCCGTGTTGCTCAAACATGTCGATTAAATTCAACT
GAGACCACCGCAAAACGGCAAGATACAGTTGAAGCTAGGGATGTGACGCGAAGGTACGCACTCTGGAATGTGACACGAAGGTGCATTTGTTTGAATGTGA
CACGAAGGTGCCGAGCCACAAGCCACACAATATCCGCTACATAGAGGAAGCTCGCGATCGACATGGTGCTCCACGTGCTCGGCGCTCTCCGTGCGGCGGG
GCGACGCGCCGCTACCGCCAGGTTCTTGGCCACTCGCAGCATATTGCAGAGCGCCACATTCGGCACGCAGTCCAGTGGTGCGTGACAGTTAACAACGCGA
GATTTTTTGGCACTTGCCTTTTCGCTGACATCACTATTTGTTTCTTATTTGCTGCCAACTATATATTTAGTGTACACGTGGGGAAATGGCACGCTGGGCC
AATTAGGTCATGGTGAGGTGGTCAAGTCGGGCATCCGCAGTGCGTACGAGGAGCTGACGCCCAAGCTGCTGGAAGCGTTCGAGGGCAAGGCCATTACTCA
CGTGGAGTTCGGAGCTAGCCATAGTGCTGCCAGTATGTCAATTTGTGGTTTTCTTATTTGTTTGTTTGTTTTGGTGGTGCTGATCTAGTATTTGTGCCTT
TGTGTGCTTGTACTAGTTGACGAGGATGGCAAGCTGTTCGTGTGGGGATCTAACGAGTACAGTAAGCTAGGACTGGGAGAAACCAGCGAGATGGAGACGC
TCCCGCGTGAGGTGGAGGCTCTCAAGGGCATCAAAATCGTGGACGTCTCGTGCGGCGATTATTTTACGGCTGCAGTGGACGCGGACGGCAAAATGTACTC
GTGGGGCTGGGGAGGCTCCACCATGAAGGGTGCAGGTGGTCTCGGCCACGCTGGCGGCAAGGACGAGCCCACGCCGCGTCTGCTGACGACACTGGTGGAC
CAAGGAGTGCCCATTTCCACGGTGGAGTGCGGTGAATTCCACACGGTGGCGCTCACCAAGGATGGCGAGATCTGGGCCTGGGGTAACGGCGAGTACGGAC
GTCTGGGCAACGGCGAGTCCGACACGTGCGAGGTACCAGAGCCTGTTGAGTTCTTCTCTAAGGACAACGTGCTTTCTATCGCTGCTGGTCGTGACTTCTC
CTTCGCGCTGACAGAGAAGGGCGAGCTGTACAGCTGGGGAGGCAACAGTCGTAAGTTGAAGCTATGGGGTTGGCGATCTTTGTGAGTGATGCTCAATTGC
GTGTTGTGATGCTACCACAGAGAACCAGCTGGGTATTGGCGGTGGTCTGGCCATGGATGTGTACAACATTGAGTCGATTCCGGTGCTGGTTGAGGCGTTC
AACGGTCTGTCTGTAAAGCAGATCGCTGCCGGCTACGACCACGCTGCCGCTGTGACGGAGGACGGACGTTTGTACATGTGGGGCGCTAAGATCTGGATCG
AGCCGCACGAGATGACGGCCGTGAACGAGCACAAGATGGTGCAGGTGGCCTGCGGGCGGCAATACACCGTGGCACTCACGGATGACGGCAAGGTCTTACG
TTTGGCAAGGGTAGCTCCAACTGCCTGGGCCACGGTGACCGCAAGAACCAGCTGCAGCCTCTGCAGATCGAGGCTCTGGCTGACGTTAACATCACCTCGT
ACGTAGCGGACCGTTTGCGGCGGTAAAGCGAATTGCAGAGCAGAAACTAACTGACCTCTATGCTGTGCAATGCAGGGTATCGTGCGGCGACTACCACATG
GGCGCCATCGCGACACCCCATGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAAGTTGGCCAGTCGTAAGGGACAATAAATCGCGCGCGGT
CAACCTGATGCTGTTTGCTTCACCTTGCTGTTTACCGAGGCTGGTTTGCTCGTTCGTGTAATCCAGGACTCCGCAAAGCGTCGCCGATCTTTCGAGTCCA
TTTTGCAGTCCTACCGTTGTTGATGATTCGCGTGGTGTTAATGTGCGCGGCAATTCTGCCTTGGCTTCTGCTGTTCTCCGGGCTGTCCCTGCCACCGAAC
GATGAGTCAAACTCAACTTGGCGGCAAAACGGCGGTGTGGCTGTGTCGTTGCTGAATGGAGTATACGCATTCGAGTGGCGACAGGTTCCGCGGTGGTGGA
AAGGAAAGCGTCAGCTCACTCTCACACTGGACACGTGGCCCGAGCCGGAGATCGACATGGACGAGTGTGTGGCTCGCTACCAAGACTCCAAGCGCGACGA
GGTCTGTGTCATCAGCCGGTAGACAACTATGCGAAGGGGAAGGAGGGGTCAACCGACGTATCAAATTAGTAAATCTATCGTTCTATACTGCCTTGCAGTC
TTCACTTGCCGTCACGCTTCCGCTTGAGGTTGTTACGGCTCTGCATGACAGCGGAACCGGTGCCGTCTGCCGCCACAACATCCGTGACAACGTACGGAGC
TTGGGCCGGTTCGTGAGCGGATAACATGATGCTGGCGAGTGGCATGCTGCTACGGACCAGGAGGTTGACACGCTTTAGTACTGACAGCGGCAACGGACTC
AGGACAAACAATCGACGCTTCTCGGCGTCCACGGCGCGGATGACCCCCACGCCCACACACGGTGCGTGCACTGGCTGCAGCACGATACGCGGGGGTCCTT
CTGTGTCTTGCTCGAACGGTTTGTAGTCAGGGTTGATGCAGAGACCCACGATGCAGGCGTTCAACGAGAACAGGAGCTGGCTCGGAGGCACAGAGGAGCT
GGCGAAGGAGATGTCGACCTGGTCGAATGGCACCGCGAAGGGTGGGAGTTGAGAATACGCGCGGTAGATGTTGCTGTCCACGCGGTTCTTCTCCGAGAGC
ACTTGCAGGTTCTGCAGCAGTGCGCGCGGGAGGTCGCAAGGAGTGCGGGCGAGGAAGTACGAGTGGAAGCGATACAGACGCATTTCCTTGGAGCTTCGTG
GGGGTTGAGTGACGCCAACGGGATCCCAGGGAGGAACTCCGTGAACGCGCCACCGACCGTCCGTGGGGACATCAAACTGTTTGTTTTTCGTCGCGGCAAC
CAACTGCACGACGTGATCGGGGTTCGTCTCCTGAATGACGTTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCATCCGTCCGTATTAATTACCAGCGGA
ACGCGAGCGCTTTTCGGGGGACTCGAGTCGGCTCCGCTTCCCCACTTGCTTCATACAGACGCAGCAAGCTCTTGACCGCCTTCATGTAGTACAGCGGGTC
GTTGCCCGGGTTGGCGTTTCCGCAGAAGAACGACCGGACCGGATTCTTCATGTGCGAGAATCCTGGACCAAGCAGCGGCGTCGTCAAGGCGTGCAGCGCT
ACAAGGCCCGACGGCGTGAGCTCACTCTGCCCCAGATCCGTGTCCAGGAAAGCGACCGTGTCAAACTTGGCAAGCAGTCGGTTCACCAGATACCTGCAAA
ACGTGGACTTGCCCACCCCCTTGCCGCCACAGACCACAATCTTCTGATACGCTGGAGTCGCTTCGTCCAGCAGACTCGACTGCAACCTGTCCGCAGTATC
CTGCCACGCCTCTGTGAAATGCAGCGTCCTGAACGAGTCCACCACGACCAGCTCAGCCAGAACACGCTCCGGCGACTTCCAGTCATGATGCAGCGGGTCC
GTGTTAGGAGGCGCCGCACTCGTACAGTCGAAGCCTGCAGTGATGTCGTTCAGTTCGTTCTGGTTGTGTTTGGCGACCATCATCTTGAAACCAGGCAGCA
CCGCCGCCGGTTTCTCGGGTCTCGCGTTCTCATAGAAACTCGAGATATTGCCGAATGTGACGGGGATGGCTCGCAGCACCAGCACAATGGGGAAATCGTC
CGCGAGCTGCATGGCCAGTCGGTCCGCCGCAATCTCCTCGTCCTCGCTCAGCGCTTCGGGTGGCAGGTTTGGCTCCATGGCCTGCAGTAAACTCACATTG
ACAGGTCCGAACGGCGCCTGCGTCTCCTCATTGCCCGAACGCCCCTCGATCACCAGCAGGTTGTTCCACTTGGGTGAATGCAGCGAAAAGTAGACGCCCA
ATGGCGGCCGGAAGCCCAGCACGTCCACGTTCCCCTGGAAGAGCCGGAAAAGCGTCATACCGGCGCAATTTACGCTCGAAAACCTCTGCATCCCCAGGGC
AACCACATTGCCCGAACGCACACAGAGCGCGCGGTACAGCGGTGAAGATGCCGACGCGCCGGCCCCAGGACCGTAATGCGAGATGCTCGTCATTGCGACT
GATGATTGGCCACGAGCGATATGTGCGATTCTCACACGTCACATGTCCTTAAACGGAGGGTTTAGCTGCGTGCTGCTTCAACATGACAGACCAAAAAGTC
TGTCCTCCATTCTGTGAGCTCCAGTCTTGGAGAGTACCGCCAAGAAATAGGCCGGCGCTGACGAAATGCATCGCTGAGGTTTTGGACAAGAACACTTTCC
GCCTATTCTCGGCACTGCGTCTCCATCCGTGCAGCCTCGTCCTGAAACCAGTCCGCAGGACGTGGAGTTATTTTGGAGCGGTTGGTCTGATGCTAACAGC
CAGCTTTTGACTTCCAGCGTTCACTGGTCTCGTGCCGCGCTACAACCACAAAGCGCCGTCGAGAACTGCGAGCAACGAGCACGGCATGTTGCCGGCGCTC
ACGACAAAGCCCAAACAGGCGGTGCGCCAAGTCAAAGGCCTGTCCAATGACTCGATCGATTCGTACTCGAACATGCCGCTCGGTGGGGGCGCGGGCATTG
GCGCAACATACGTGGATAATACTGAATCGGGCAGTGGAACGGCCCGCGGGTCTCCGCCAGCGTCGAATAGGTCGACAATCAACTCTGGGCGTGCTTCTGT
CGCTAAACCTTCAGCTAACGAGGAAGGTGCGACCTTGGCTCGTGTAGTGCGAGACCGAAAGGCTTCGGGTGAAGAGGAGCTGTCACTACGCACGGGAGAT
ATCGTCAAAGTGCTGTCCTCGAAACGCACCGGGTACCTCAAGTGCGAAGCAGGAGACGAAGTGGGCTACGTACCGTCGTCCTATCTGGAATTCCTGGACG
AAGCGGAGAATGCGAACGGCACTGCAGCATCAGAGGAGACTCAGACGCGTGCCGCTGAAAAGCAGCGCAAGAAACAACAACGAAAGGAAAAACGAAAGAA
AGAGAAGCGCGAGGTTAACGGTGCTAGTGACCCGGAAGAAGGAGCGCCAGTGTCTGCACGGTCTCCTCGTAAGGAAGTCCCTGCAGCAGAAGACGAAGGC
AATGAATCGCCACGAAAGAGTAAGAAGAAGAATCGGAAGCATCGTCCGGATCGAGAGGACGACGACGCAGGACGAGCGGGAGCTTCCGGCGTCGATGAAG
CTCCGACCAGTGCCAGATCTCGAGCAGCACCCGAAGACACTGAACGGTCTCGTAGTAAAAGCAAACACCCCAAGAAAAAGCGCCACCGCGATGCAGATAG
CAGCGTGTCGAGTGGAAGTGACGCAGGAAAACGAGCTGCACGTCACGGACGCCGTCGTCGCCATCGACGCGGTTCAAGTGAAAGTGATTCGGGCTCGACG
TCTTCTGATGATTCAGATGGGAGCTACCGGCGAAGACGACGCCGTCGCCGCCACAGACACCGACGTTCTAGTGAGGAGGAAGAAGAAGACGATAGCGACT
ACAAACGGCGTTCAAGACGGAGCAAGAAGCGTCGTGATAAAGGCGGCGGTGAATCTGAGCCTGAAGAAGGGTCTCGGTCAGCTCGGAAGGCCGAGAAGAA
GCTAGCTGCAGCCTTACAGGAAGCAGAGAAAGGAGTGAGTCAGTTAGACGTGAGGTCCGATGAAAAGGCATCGGAGCCTGTGGAGGCGAAAACGACTGCC
TCATCGAACAAGAAGGAGGACCGCGAGAGCGAGGGAAGAAGGAGGAGACGGAGCGGAGTGAAGGTTCGTCGGAAGGGCGGGCGACGAATGTTTCAACGGG
ACGTAAGGACGATGAAGGGCGTGCCAGTAGCAGCGCTTCGTCTTCAAGCCAAAAGCAGAACGGTAACAGTAAGACTGGTCTCGGCAGGCAAATTGGCGAC
AAGATGCGCTCATTCCTGGGTGGTAGCAAGAAGCAGCACAGCAGCAAGAGTTCAAGCGGCATTTTGAACGCATGTACAGGCACAGTTCAAGGCGAGGAAG
GCTGGTACGAGCACGGCGAGAACGAACGCTACTATTTCGTGCTTGTAGATGGAAAATGGAGTCTTCTGTACGGACCCATGACTGAGGACGACTTCGAGGT
ATTTTCCAACCGGGTACGTTGCTTCGTTCTCCTTGAAAGCGGTCCTCCACTTTGTTCTGACCTTTTTGCTGTGTTGTGTTGCTCGCTTGCAGGTGCTGGA
GCAAAGCCGCTCCATCGAGCTGCCACCGACGTATCTGCACAAGTCAGGATACTATCTCAACCGCGAGCTGCGTGTGCAGAAGGGAGAAGTGAACAGCATA
AAGTACTATCAGCGCTTCCTCCTCCTATCACCTTCTATCGAATATATCATGCGAACGAAAGTTGCCAGTAAGCAATATGCATTATCCATTCATTAGAAAG
TGTTGGCTAGCCTAGCAAACAAGCAATAGATGCAGGGAAGCGCTTGGTATTCGAGTCCGTCGTTCTCTTACTTGGCTGCACCCGTGAGCGATGCGCTGGG
AGTCTCCAGGACGACTTCCTTCGGGAAGTAGAGCTCTGGTTTGATGGATTCCTCCTGGGGACCTGCACCCGTAAGCCACTGTGAGGGAGACCGCAGCAAC
TCCTTCAGCTCCTCACTTAGCGATAGCTTGCGTCGTGGAGAAACAAGTTGAGTCGCCCTCTTGGGTTCGATCGACACTTTGAATTTCTCCGCCTTGTCAC
CGCTTGACGCTGAAAACGCCGCATTCGCAGCAACCGCATTCCTCACGACCTTCCAGTTTGTGTGCTTCTCATGGGGCGATAATGGCTGCGCCACTCGCTT
GGAATGGGACAACTCCTTCCACGTTGTATCATCCACGGACTGATTGGCGATGTCATCACCCGTATTCAGATCCAAACGCAGACTGGATGCCTCCTTACGC
TGTCCAAGCCGAACTTCGTTCAGCTTGCGGTCCACAAAGGTTGCCTGCAACTCAGGAGCTACCCTCTGTGCAGAAGCTGCCACCATGTCTTCACTCAACT
CCTCGGAGCCTGCCTTGCCTTCCGTATGGTAATTCATTTTTCCTAGCAGCTCTGGCGTGCGGGTAATGCTGAAAGTGCCCTCTCTGTGCATCTTCACAAG
TTCCGTAAGATGCTGTTGCTGTGGTAGCCAATGCGTTGCCACCTTGTGGTAAGCTTCGCGGTGACGCTCGTTCAGGCCATTGGGTACCACGCACACTTGT
TCAAGCTTGTGCAGCAGTACGGGCGTCTCTTCCGAGTGGAGTTTTCGGTTGTTCATGCAGCGCTCTGCATGGGTAACCAGCTTCTCGAGTAACTCGAGGT
TGGACTGGTATCGTTCCTCAAGTTTGGCTTGTGCCTCCTGCTCGCGCTCTCGCAGTCTCGAGCACTTGTCACGCACCTCCCTTAGCAGCTTTTCCGTCTT
CACCATGTCCATTTTATTAGCTGCTTCAAACAAGAGCAGACGATCAAGCAGGATTTTCACGCCGACACCTTCTCCAAAAGCAGGATCGCACCATCCTAGT
CCACGCTGTAGCCAGCGGTTCCGCAACGTGAAGGCTGCAGATGCCCATTCCAGTCTTTGCCGATGCGCAGCGCTTAGCTTCCGCTTGATGCTCAACGTCG
ATGTGTCGAATCCGAGTAGCCAGTCAGCAATAGACTGGCTGAACGTCCAGCGGCTCCACTGCTTTGGGATCGCAACGCCGTCCACGCTGCTGCATTCGTC
AAACGGGAAAGTGTCCTGCAATCGATTCTTTCCTAAATCAACACGCGAGCGGAAACTGGTTACCTCCTGGAACACGTTCGCAGCGTAACTGATGGCAGCG
TAGTGCGCCATGGCATGCGCATTATCGCCCTGTGGGCATCGAGCGAGCATTTCATCACTTGGGGTACGAATTCGACCAGCGCCAACTGCTTGTTTCAGCT
CCTCTTTCGTGAACGCCTCAGCAGGTAGCCGATAGTTCGCACCAATTACTCGCTTGTTGATGTTGTGCAGCTCCATAGCTATTTCTTCCTTGGTCACGGT
CTCATCTCGAGACTTACCGAGGAGAGCTCGCACACAGCGATCCAGTGCTGCGTACTCAGCGAGCCTTTTAGTGTACGCTTCGTGCACTAGTAGTCGCTGA
AACCGTTCCACGAGCGTCATATAGTCGCCGCTCACATCGACCTCGGCATTTTCAACTGCAGCAGCGAACATGTCGGCTTCAGTCCTCTCATCTTCATCAT
CAAGCACATGTGACTCGCCGGCAAACGTGCGCACCAGCGAATTTCGCTTGCGCAATGCTTCAAAAAGCAATGTTTTACGAAGTATCTCGATTTGTGTGTC
GATAATACCCAGCCCGGTATTTAACGCCTTCGAAGAAGATGCTCCACTTGTGTTATCAGAGGCGGCACCTGTGGATTGCGTGCCAATACGAATCCCACGT
AGTATCACAGGATCGCCTTTGCGGTCCATGCCTCGTTCCTGGAGTAGTGTCTGAATTGCGGTCGTGTCCGGCGGCAGGAGAACTTCTTTTACTTGATGCC
GGTGCATAAGTTGCAGTAACGTCGTGGGGTTCGCTGTCGTCGGAACGGCTATGCCTTTTGCCACTAATACCTCCTTCTGCAACGTGAAGGCTAGTGATTT
CACTAGATTCTCAACTTCTGTCGTTGGGATTTGCCGGAGTGTCATCTCCTTCAGCAACAATTGGTAATTCTCAGGCACGGCTAGCTCGCGATTCCTGCTC
ACAGCATGATCAACTTTCCAGAGCAAATCACTTTTACCGAGACTCTTCATCGATTGGTAGAGCTCGGCTACGCGTTCCGGATTGGGTAGCGCGAATACTT
GTTGGCTGTCATCGCGGTGCTTTTCAAGCATTTTCTCAAGCTCCTCAATCTCTTTCAACACAGTTTTCGGCAGGGCAACCGATTGCGATCCGGATTTCGG
ATCTGCTAGAGACGGAGAAACCCACGCATCATCTGAATCGTTGCCTTTTGCATTCCTGTCAGCAGTCGGGTCAAAATTGGACGTTTTAGGAATCACGCCG
CGGTCTTCCAGAGCGAGACGAACATTCGCTGGAGTGAACACCATCTCTTGCTGTGTAATCAGTAGACGGATGTCTTTCCCGTCACGAGAGTAAGACAGCC
AGTTTCTCTTTTCTGTATCCACGGTAATGCGGTGATAGGGAATGCGCTCCAGTTCGTATTTTGCCTCCTCAATAGCGTACCATTCTGCCATACCCTCAAG
CTGTCCGTTGTCTTCGGCACCACTGTCAGACCTGATACTTCCATCGGATGATACCCGACTACTGGAATTTTGATGGGATAAGCTGCGTGGTCTGCCGCCA
GCTTCATCCTTATTTTTCGGTGAAGGTGGTGCTGCTCTGATCGGATTGAACAGTTTCTCAGGCTTGTTCAATTCGCCTTGCCGGTTGGCACGCATAGATC
TCCACAAGTGCATCTTTTCAAGGATAAATGGTGTGTGCTCACAGTCGATTGAGTGCTGCTGCTGCATCTCTACAATCTCATGCAGCCACTCCTGAACTTG
CTCCCATCGGTTCTGCACAGTGTTAAGCGCCCTAGCATCCACGTCCGCAAAGCCCTCGCATTGCTCATCTAGAAGCAGCAACAGCTCGTGTGTGCGTCTC
CAATGCAATCCTTTCTTTTCCATTAGCCGCAGTTCGCTGAGAGGACCATTCGGCTGCGTAATAGCCATCCAACGGGACTGGATATTCGAGACTGCATCGG
CGTGGCGCGTACTGAGTCCTTTGCTGCAACGCTGCTCCACAATTTTTAACAGCTGCGGTGCGCGAGTCAGGTTGAGCTTGCGTTCCTGCATGCTCACGAG
TTCCTCCAAAGCATTCAGCAATATTTGCCACTTTTGTTTCACCTGCTGCCATGCTGTGCTGAGTCCAACATCGAGGCCCTCGATCTCCCGTTCAATATCG
TCCAGAAGTTCAGGTGTACGTTGCGCGTGAATCAGTGCGGCGGCTTGAATAGTCATGAGTTCCTCCAGTCTAGGTTGCATGTTAACCCAGCGTTTGTGTA
CTTTCATCACCGAATCTCGATAGGCATTTGCCACTTGTGCAACACTCTGCGTATATTCTAGCTCTTCAGCGTCAATAGCCTTCTTTTTGACGTGGGTTGG
CGAGCTCTCCTGCAATGCGAAAATATCCCAAACAAGGCTGAGCAATACCGGGGTGCGTTCCCAGTGTAGTTTACCCTGAGCCTGCTTCGTGAGCTCGTCC
AGGTAGCCTTTAATCGTCAGCCAGCGTCGACGCTGGGCCGGCACCACGGCAGCATGGAGACGCCGTCGCGCTGCTTCATGCTGTGCAAGATACTTAGCTT
TCCATATCTTGTACACATTTATGGCTTGCTCAAAGAACGAACTTTCCGAAATCTTCAGATGGAGTCGTAAACGAACTTTGCCTCTGTCTTTTTCACCAGG
ACTGTGTGTAGCAATTCTGTAGCCGCGCAAATTAGTTGTTGGTAAATACAGAAGTTGGTACATGTCGTCACGGGGCTGCTGATCAAGAAGATCCATCAGC
GGTATGCAAGCGGTGCCTAAATAGTTGTCGACGTTGTTACGGTCTTCATCCATCACCTTCACGCGAACTGTGGCTCTCATGATCATGTCAAGTACCTGAG
TTAGTTTTGCAAGTCGAAGCCGCTGGTACAGTCGCTGGCGAACCTTCTGATCCTCCAACTCCAATTCGTCCACCTCGTTGTTGAAGAACGACAATAATTT
TTCGCCCGTAGCGACATCGACTCGGTCTTCCTTGGCGTCCAAGATATACAACTCGTTCAGCTTCGGCATAAAGTGAACAATAAACACTTCGTACAGTTTT
AGTACGGCGTGACGCACTCGATGAGTGCATGTTGCCACATTGGCTTCCACAATCACCATGTTGTCGCGAAGCTGGCTATCATCTCGTCCCCATGGGCATC
AGATGACCAGGGAAGCCTTCGGTCAATGAGCCCCAACTCCTGGGCGGTGTCTTTTACAAGCGATTTCGTTTGTTGCAGGGTAAGTCGCAACTGGTCAAAA
GCGAGAGAAGTCAAGTCAGTGCTAATTCTGTTGGACGCGTTTGGAGTCGACACAACTGCTGTTGAGGATCCAGCAAGCGTTGTTGCATGCAGCTTGTTCA
TTGCGTCAAATATCAGCCGAACTTTTGTGATTTTTTGTAGCTGAAGCTCCATTTCGAGTGACTTCTCCAGCAGTATCTTCCCTCCACCAGAAACAGGAGG
CCCAGTAGCTAGAAAACTACGAGAGAGCTTGTTCTCATGCTGCTCAAGCGTCATTTTGAGCAGCTCCTTAGGGCAGATAGCCCAGAAATCCATGCTTTTT
TCGAGTTGCTTGGCGTACACTTCGGTCTTTTCACCGTAACTTTTCATTCGCGTGATACTTAAAGAAATGGTTCCAACGACGCGCTTCCTATCCGATCCTT
CGTGATGCACGCTGAAAATCGGTTCATCTTTAGGCTTGTCAGCATTATTTGTTGAGCGAGAGACGCCGATTTTTGCCATTGGAATGGTGACGATTCCGAT
CTTTGTGTTCGTCTTCTTGTCCCGTACAATCATCTTCACATCAGAAACACGATCCAAATCAATAGCAGGGTACGTAAACTTTAGCTGACTGTCCGGCTGG
AGCGCATACTTATTCTTCCAAGCCACTGATGTCGTTAATGGCGTTGACAGCGTTGTCCCTGCTGCCGTTTTGTCGTTTGTCAGTGAAAATACCGAGTTTT
TCGGGTAAATCTGTTTGTCCGCATCCGGCAAAATTTCGCCTGTCGAAGAGAGCGCCAAACCAAATGGTGTAGTAACCTTCTTGTCATTAGCCATGTGCTG
CCGAAAGTCACTGGAAACGAGTAGCACTTCCACAAGCAGCCCGTCAGTTCCCATCTTTTCTTTTAATGTCATGTTACTCGCTTCCAGAACTTGCACACTG
AGCTTGTCGAACTTAATGTCAGCTCTCGGTACTTTCACAGCGGCAGTATTAGGAGATTTGTTAGCGCTCGTCTTCTGGAACTGAAGGTTGCAGTGAGACG
TGGCAAAAGGTCCAGGAGCAATGTAGGCTTTGTGGAATGGAGAGAGTTCTCTGCGAACACGAGCTTCTGCCAATACATCGTACATGGGGAAATGCAGCTC
GTGAACATTTTCGTCGAAATCACGAACACTAACACGGATGTCATCAAGAGGTTCGAGTTCAAGTGAAACTTCAGGTTCAGAATCGAACCTACCCTCCGCA
CTAGTGAAGTCAACCGATAGCGCCATGCTGGGTGCTATCATTTCCTCAGAAGCAGCCAGGAGCCACGGCAATTTGCCAAGATCTCCGAAATCTGTCAATG
GTTTGTCTCCTTCCACGGCAAGTGTCTTTTTGAGCTTTAACCGTCCCGAAATACCAGTGGCTTGTGCAAACGAAACATTCACCGCATCGCTGATATTCCC
GTGGTCATTGTGAGGCATCGATAAACGGAACTTAATCTCGATGGTGGCATTAGATAGCGCCACCCCCGTCAAATCGGCATTATTGTCGCCTACTGATGTG
TTGTCAGAAGGCGACGGCATCATGTTTACGACCACACTGCGACTGGGAGTGTTGTTGAAGTCTACTTTCACAGCTTCGATCATTACAGTACGTCCTTTGC
GATGAAGCTGAGGGTCGATGTTACACTCCGCACGCAGAAGTCGCTGAAGGATGAACACAGCCGAGCCAGGAGTCTTTCCCAGCGTAGCCAAAACCAATGC
CTTGAAGAGTGGGCCCGAATCGGAACACGAACTCACGGTGACAGCTCCACGAACTTGCACGAGCGGCGGCGGCGCCAAAATAAGGTAGAAGCAGTTTTTC
TTACTAAATGGTAGTGTGCCATTTGAGAGTGTGTTGTGCATGCGACGTTTACAAGCTGCGGTGTACACCAGCTCAAGCTTCTCTTCCTCTGCTTTGTCGA
AATTATCTCCTTTCACAAATCCATGGTATTGGCCTAGGAAACGTGGCTGGTCCTCGCTTCTCTCCACAAGAGCTGATTGAAGGAGCTTGTTTGTGGTCGC
ATCGCGCGCTTGAATAGTTTTCACAGCAGAAGGAAGCATTGCATACACCTTAACAATTTTGTCACTACCCCACCAAAGGTTGTTCAACTTATCAGCCATG
GTCGTGGTTGAAGACGAAGGCTGGGTTCCTGTTTTATCCAACGTCTGCAGACTAGAGCTGAAAACGGACCCCAGCAATGCCGTGTCAGCCGCAATAAATT
TCTGGCGTGTACGCAACTGAGATCGCTCCAAATTATCGACCAACTCGCCACTCTCGAGCAATGTGCTGTACTTCGCTGTAGAAGGAGAGTCATCGATTCG
ACTAGTTGGGTGATAAACACTGCTCACTCTTCCATCATACATGATTCCATCGGTCACTGGAAGTAAGCGCTCTCGTGTCACCAACTTCTCGTCCTTGGGT
TGCTGGCCATCCAGGTACACGATATCATATCGTGCATTACCATAGTTGTGGGAAACTCTTGCAGGCCGAGTAGATCCTGTCTTCGTAGAGGTTTTCTGGG
GAGTGGGGTTCGCAACCCCATCGTCAATTTTGGCCAGGCCAAGGGTCGAGTGACGCCTATCTCGACTCTCTTCCGGCGAGACGACCGCGCCCCCGTTGAC
TCGTACATAGTCTTCTTTCTGTAGTTGTCCCTTCAAGACCCCGCCTTCTACTTGCGACAACGTAGCTTCAATAGAGTCGCGTGGTTGCCACTCTTCATGA
GGTTGTAGGTGGTCGAGGTACTCAACCAAGTAAGGGCTTTCTGGATGCTCTTTTTCATCGAAGTGTTTTAACTTTGCGAGGCGCCCCTGTTTAATGTCTC
GAACCCGGCGATTAGACACTTCGGGATCTTTTTCATCATGAAGTGGGCATACAAACACAGTTTCCTCCATACCAAAACCCGTGCAGAGTTTTATATCGTA
CCTACCGCCTCCCCATTCCTTGGCAATAATCGCGGCAATAAATTGGCCACCAGGTAGTTCCACGTCCACAGGCACTCCAGCATGCTTGAACAAAGGTAAC
TGAGCCGTGACTCGATCGCCAACGTGCAAAGGGCTCGACCGCTCTTCGCTATTGCGACCCGCACCAACTGAATCGCCATTACTGGAGGTGAGACCACCAC
GAAGAGACAAGACATCGAACCCCGTCCACTCACACTCTGTGAAAAGCGCTTCGATCAGGCGTGGTGTCTTCTTGCCATGTAGGTGCCCAGTCAAATAGTC
TTTCGCCTCAGTCACTTGAGTGAGTACGCGTGACCATCGATTGAGCACTGCGTCCACAGCAACTGCATTTTCATAGGAGAGCCGATCTTTCTCTCCACTT
ACAAATACGACTTCGAACACGTACGCAAGTAGTTGCGGTGTCACTTTCCAGTGCAGCTTGGACGCATGACGCATGATGCGCACCTGGGCAAGTAACTCGT
CGCCAATATTACGACCAGGAAACACGTTCGTTCGACAAGTATCCCACAGAAAGGTGTGGACATCCTTTTGAAGTTGCTCTGGCTCGTACCGCCCGCTGTT
TTGGTTTAAAGTCCGAGAGTCAAACACAAGTCCAACCAAACGGAAAGTGTCTGCCAATATTCTCCTTACGCGATCTGCCCGAAGAATTCCAATCAAATTG
AGATCGAACGTCAACGTCGCTTTTTGCTTCGAATCTCGATCTGTCAGTACAAGCTTTTCATCTCGAAAGTTTGCACACTGCTCAGGGTTTTTCAACGAGA
ATTTGGATTTGCTACCCTCCGCTTTGCCTCCTGATTTGCGTTCCATTTTCCGGTCTAATTTGCCAAGCTGACCCTCATAAACTCTCCCCTGTGACTCTGA
GACCAAGCGTACGTCAAAGTAATCCACTTTCGATAAGTCGTACGTACGGCCCAGGATGTTGTATGCCCCACCAACCGAGAAAGAATTCGCCTGAAGTGAT
TTTCCGATTTTCGCGGTATCAGAGCTCAATAGAGGTGCTGCTTGACGGAGAAGTTCGCTGAACTTGTATGGGTTACCAACGCCGAGGTCTTCTGAAGCAG
GGTCGTATTGGATTCGCAATCCTCCTTCGCCATGAGGCTGGAAATAACACGTATACTCGTCCCAGTTTTCGTCCTTTAGGTCAACATCTTTGATCGCCAC
CTCTGCAGAGTACGTTGTGTCGAGCTGTTTAGCATTCGGGTCCACGTAGTTTTCGTTGCGCATTATGTCCACCGAAAAGCGTAGTTTACCAAGTAGTCCA
TCTGGGGCTGGTGTCTTCTTTGTTTTAGGCTTCGACTGACCTGTAGCTGGAAGTAGCATCGCCTCAACCTCAACGCGGCCATATTCATCCAGCGTCAGTT
CTTGCATAATAGTTCCCCCGAGAGCATCAGCCTGTTTCAACACGACCCCTCTAATATAGCCCGTTTCGCTTCGTTGAAACTCGATGGTTACGCAACCCAG
TGGGTCATTAGCCGATGTTTGGTCGAAGTCCATCACACGAAGTAGCAGTGCCTTCTTATCCCTCAGCATGGTTTTCTCCGTTTTACCGAGCAGGAATTCT
TGGTTCTCCCACTTGGGGTTTAACGTCTTCATCTTGATGTCAGTTTTTAAGCTCGTATCCCGCTCCTTTGAGTCATCATCTATCAGGACCATCTCCACAA
ATGGGTCGCTTGTGAAGAGGTCTGCTACACGTAAGCTTCGGCCCTCCAAAATCGATACCTTCACGAAGGATGGTTCCAACCCCACTACAAATGGGATTTT
CTTCTTGGGATCTCTTTCAGCGTTACCTTTCGGGGTCAGGTTCTTTTCCTGTGGTGGCGGCGGCGAGACCTCGCTTATAATTGCTTCAATAAGGGAAGGA
ACCTTCGCACTGCGCTTGATATCTCTCTTGTGCACAAGCTTAAGCTCCACCCTTATTTGACCAAGGCGAGTTTTCTGAAGCATGTCACTGGCAGGTGCAA
GGGGATACCATGCATCGACCGTACGATGAGGTGATATCATCCGAATAGGGATCTTTAGAACGCCTAGCGGCTTGTGGCGGTATCGGTGCTTCACCATGCG
CGAAACACAATTCTCCAAATCTGTAGCCTTGAACAGAATGTTCAGATCGGTGCACTATCACTAACTTTATGAGGGTCCAAATCTCCTTCGCTCGTGCGAA
TCAGCTCCCGCATCAGCCCCTCCTCGACAATCCGTTCGTTATTGTGACTGTATTCCACGTCGTACAGTAGGAACATGTCACGCTGCGCTTTAGGGAGGCT
CAACCACGATGCTTTGTCTGTCACCTTGTACTTGGCCAACAGGCTGCTCAGCGATTCTGGAACCTCCATTTTGTTCGAGATATCGTATTTTGCTGTGAAC
TGATATGTTGGATCGGTGAATGGCGTGCGAATCCGAACAATGCGTCCAGAATACAACGAGTCCCTCTTGAAGTTTCCACTTTGCATAGGCTTGGACTTCA
GGTTTTTGCCTTTGCCATAATATGCCATCACGGTCTCACCCACACACCCTGGCTTTTTCAGCTCTCTCCGCACTTGTGCACGGAGCTCGCGCGACTTCTT
TTCATGATCCTGGTGCGACAGCTCCCTGTCGTGCCCAAAAACACAATTCAGCAGCCGGTTGAAGCTTCCTTCAAGATCGTTGTGATCAAACTCTGTGGCG
TGCTTAATACACTTTTGCTGCAAAATTGTAGGGTTCAGCCGCTTCATCAGAACCATTTGGCCAGGACGCATATCAACGCAAACGCCTGAGCTTGTCAGCG
CTTGGATCCACTTTTGAGTATGTGGGGTTTTAACTTCAATGACTTTGTCCCCCTTATCTCGTGTCCTTGCCATTTTGTCGAGATTTTCAGCGGATATAGA
AACGAAGTCTTGGGAGTCAGGCTTTCTGACGCACACTGTCGGATTCACAATATCCATCCATCCTCCTTTCGCATCGTTCGTGAAGTTATAGGCTACTTTG
CAAGCCGCACTTGCCATGTCAATGAAGGCCACCGGTGTCGTGGATGTTTCTTGCTCATACATGTACAAGTGCTTACGACTTGGAACGAAAAGGCAATACT
TCCAATCCCACAACACGTTTTCTGCATACTCTTCAGCTTTTTCAGCAATCGTTTCGGCAACGGGTTGTAAAAAAGAGTTTTTCCTAATATCAGGGGAGAA
TAGCGTACTGGATGCCAAGGTGTGCATGCCTAAAAAGCCGTCGCAGTGCTCAGTAAGTTTTTTTGCGTACGTCTTGCTTCGTTTGTTTGTGATCTGCTCC
TGTTCGCTTGAGCTATTGCCTGCGTTCTCGTCCACAGATCTGAGCACAGGTAAATCTGAAGCTTGGTAGCAATCGATTTCTTGAACAAGATCGATTGGAA
ACAAACTCTTTTCGCGTGACAGCTTTTCCATCCACATATCTACTTCACGCAAGCGGTAGAAACGATCCACCTTGTATTCCAGCAGTACTTGCCTTTTGCC
GAGGTCTGTAACAGCAGCAATCCCTGGAGTAACGTTTTCCACAAAACCAGCAGCACACAATGCACTAAGCCACTGCAATGTGTACTCGCGCGTCGTTGGT
GCTTGGATTGCGTCGGGATCAAACTCCAAGTTTGCGTTCCTCCACCCTAACCGACACGAAGACTCAAGGGCACTACCCCGGCAGTATTTTGTCCACCCAT
CTTCCCAAAGGACGGGAGGGTGACGCAAAATCCAAGAAATCATACCTTCACCTGTGAAGCTCCGTGGGACCGACAGAACTAAAGCACTCGTTTGGTCCCT
CATGAAAAAGCTGCCGCTTTCGCGAAGGAGCCTCTGTCGATCAGCGCGCAGTTTGACCCATTCTTCTCGAGGAATATCAGCGTCAGGGAAAATACGCGGG
CCAGTAACTCCTGCCAAATCCAAGAGCTCATTTTCCAACCCGGCCACTACCTCCTTCCGTGCTTCTAGCGATAGCTTGTCCATCGTGCAGCCGAGCCACT
CGCTGGTCGGATCAGCATTCACGGTGTGAACTTGGCGACACTTACGCATGTCATCTGCGGAAAGCACCTCAAACTCTTCGAACTGACGAATCTCGCGTAA
AATGCTTACGATCCGCTTCATGATGACCACGAGCACGGCGTGAAATTCATCGATTTGGCAATTCTCCGTGGGAGTCAGCGACGAACGAAGAATTTGTCGT
CGCTCAATCCAAGTCACTCCTCGAGTTAAGATAGATGATGATTGAGCTTCAATTTTCACTTGGCGCTGGTACCACATGCTCAATCCACACACGGAGAGCC
GGGGCTTAAAATCTCCTGCTTTGGTAGACGCTTGCATTTGTCGTGGCTTAAACGTATCCGACCATGTAGTGATACGAAGGAACAGGGATCCCACAAACTT
ATAATAAGGCACGTTCGTCGTATCGGGAGGGACAATCTGCAAAGTTAAGTCCTGCTGTCCACTTTGTAGCATAGCGAGATCGACTTTCACAAACCCAACC
GTTTGGTTACCTGCAGCGTCCTCGTTGTCCACACGAATCAGGATGCTCGAAGCCTGTTCGAGAATCTGATACCCCATCTTTATTTCATGCGGCTCAACAG
GCTGGTAATCAGTGTCCCCAGGCGGAGTGGCATCCACCCTACCCATTACCAAGGGTTTCTGCTGGAACAAGTGCACATCATCGGTCTCTGCAGACCCATG
CAGCACAGTAGCCGCCAAAACCTCTCCCTTTTGGCAGTTCCAGTTAGACAGTGTCACTGTGTCACCCGGAATGAGCTCACCTTGTTTGTTAAAACGACAC
GTGCTGGATGCAACCTGTTTTGGGTTGCCAAGCATTGTAATTCGGCACGTAGGCTTGCTGGTCTTATCCAGTTGTTTGAACTTTTGCGGCTTTCCGGCCT
CATTTACAGGCACCAAAAGATCCGACGCCGATAAAACATCAATGACAATTCCAGAAAACTTATGCTGCAGCTTCAACCACCGCTCATCTTCTTCTTTCTC
CATGTCAAAGCGTCTGGCCATCACCATCTCGACCTTGTCCGTTAAACTGTTTATCGGAATGAGTTGAGTAGGCTTTACAGTGTACCGCAAAGTACGCCTG
GCTGAATTTGCAATAGCAGGTAGCTCGTTCTCAACGCTCACATCCACTCTACCATCACTGCGCACCGCCTGGACTGCTCCTTTTACATCGAACGAAATTA
GGTTACGAAGCTCATCGATTGTATCAACTTCATCTTCGAAATGGACATCGTATACGTCGTCAGGGAACGGAATGTACTTCTGAACACGAGCCGGGTAAAA
GCGTCCACCATTATCGCCACCACGAAAAGCCAATATTCGTTGACCGTATTGCAGGATCTCGAAACCATCGTCATCAACCTCTCCGGATGGCGTCAGTTTA
TGCAGTTGGAAGCGTTTAAGACGTGCGTCTTGCTTCTTTTCGTCATGGTTAAGCAATTTTGCCAGAACCTCCTTCTGATCATTCTGCAAATCTCGGCCGT
ATAAGTGAAGCGAGAGGTACGATACATTGGCAATATCCTTGATCTTCCCAAATACGAAATTCTCTTCTGGCCAAGATGGATCGCGTGTGTTGTAGACAGT
CAGACTTTGCTTTCGCTCGGCATCTTCCAGCCTCCCGTCGCCAAGGACAGGAATAATGGTGAAGTAGACATTTGTCGCGTCTTGAGCACGTTCAGCGTTT
CTCGACATTCCATTTGTCTGAGAATCGTGAACACCATCAAGCTCGAGTGAAGACGACCCAATATTGGCACTTCCTGCCGTCTCCGTGAGTAATAAATTTC
GAGCCTCGTGGACACGCAAGTGGAGTACATGAGTTTCACTGCTTGGGTACTTAGCATCACTGAAAACTCCAGGATACGACAAAGAGAGCGCGAACTTTTC
TTTGCGCCACGTTGCTGTTGTACCGAGAACCCTCGAAGTAGATGTCTGAATAGGCAGTCCGCGCTGGATAACTTCCGTTGTTTCGTCTTCTAGCTCAGAT
CCACCGATATCTGTCGCTGACATATCCATATCCATTGAAACTTCGCTTTGGATATTTGCTTCTGAGAAGGTGAGAATACTTAGTGACTTTTCCATCGGGA
CAGTAGACACGCGTTGCATTAGCTCCGCCAGAGCGGTCGCATCTCCAACCACATCGGTTTTTATACACAGCTCTCCCAAATCCTTGGCATGCTTTTTCAT
CCAAGGTTCTGGTTTAAGTTCATATCGTTTCATAACTGTTTTCGACGAAATTGAGGTAAAGCCCGCAGATGCCCGACAGAGATCATACAAAGGAATCTCC
ACACGTCCAAGCGGGGTGCTCCTCCAATATTGTTGTGATCTTTAACGTGGATCAAGAGTGACTTGGCATCTGAAAGCGGTACGCTCTGTGAGAACAAACA
ACAGCAAGTCAATAGAGTTATTCGCACAAATCAAAAACTACCGCGTTTCACAACTTACGTTACCAAACAGGAAGTTCTCGTTAGTCCACACTGGATTAAG
CGTCTTCGAGACCACTGCTGTGCGCTTCTTTTCAGCATCGATAGCCTTTCCGGTTTGATCAGTGATAGAAAGTGTACAGTACGGATCGCTGTAGCCATTC
ATGTCAGCCGGGCTGAGCCCGTGTCCCGTGAGGATTTCCACTTTCAGAACTGGTTTGTCAGGGTTAACCTCCAGCGATTTTTCCGATCGCATTTCGTTCT
TCACCAGTTTTGATCGGTGCAAGGATACTTCCGCCTGGGAACGTTTTGAAAACATCGTATTGCGTGCCTCGGATGCAGCAGCAGCAATCCGCTTGCTTTT
TTGCGGAGACAACGGCGCACTTGTACGTTTACACCCCTCAACGCATACGGATGGGTCGATTTCGATAACAGCGTACGGAGTCGCGGTAGTCCCCGTATCA
CCACCTTGTTTTTGCTTCTGTTTCAGATCGGATGCCTCAATTACCGTCACTTCAAGTACTGCCTGGCCTTCCAAGCCAGCTCGGGCCTGAAAGCCTTCAT
CGGATGATACTTTCTCTTGATGAGCACGCGGAATCTGAGAGTTCAAGTAATGAATGCAACCGTTGATGCCATAAAAGCGAGGATCCCGTGCCTGGTAGTC
GGTGACAGCACACGGATACGCGCCCCATCGAGCTTACAAGCAGCATCATGCAGCTGGAACTGGGCGTTTTCCAACTCGAGCTGCTCAACAGAGATGTTGT
GTCTTTTCGTGTTTAGCTCCTTTTCGATCTTCAGCTGACGAACATGCTCTCCACGTCTCTCACCAATCAACCAGATTTTTAGCTGTATCGCACCAAGGTT
TTCGCGAACCGACATGCCTTCTTCAGGTTGCAGTACGTGCCACTCTGTCCACTTGTGAGCCGAAAGCTGATCCAGTCCAATGTGAACAAACCCAAGGGGG
TCATTTCGGTTGGACTTGTCGTAGTCGACTACCCTTACTTTGAGGCTGGCTGCCTTCTCAATGTGGCAGATCAATCCAAACACGTGGTGCTCGTCAGCCC
ATGCAGGGTTACGCGTCCGATGCATGATTGCAGTCGTGGCGTATTCTCCAGGGATGGGTTTTCCATGATCATCTAGCAAAGAAAGCTCGCAGTAAGGATC
CGACGAATTGTTGAGGTCGGCGCTGATCAGGTCCCTCGCAGCTATAACAGTCACTTCTAAGCGGTTATCTGTGTGCTCGTTACTTGCCGTAGCCACAGGA
CTTGTCGGAACGAAAGCCAAGTCTGAGCTGTGGAAGAAGTCAACAAGATTGGGCCCAGATATGCTCATCTGAACGCGCAGCTCTCCCCAGTCCTTCACGA
CGTGTTCCTTCTCCCGGGTATCATTGCGTCGAGGAGACGACGATAGACCAGTTTTCTTCGGCGGCTCCACACGAAACCAGTCGTCGATCGGCTCCGACTG
AGCCGTGCTTGCTGGGGACATGCGGAACCTCGAGAATGGCACCTGGACTGACCCCAAGCTGTCGTGACGCTTGAATGTATCATGATCGAACAAGTCGAAC
CGAATAGCCTTCACTGAATTCAGGTCGACAACTCTGCCAATCTCGAACGGCTTCCTCCACGCCGGCTCGAGAGTTGCCGGGATCACCTCAGTGCGTTTCT
CCTCGACGTCGATGACCTGTCCATCTTTGCCCACCAGCTTTACGACGCAATACGGGTCGCTTTTCCCGTTGAAGTCTGCAGCTTTCAGTTTGCGAGCCTC
CTCTACAACAAGCTTGAGTAATATACGCGAAGGTGGGGCTGGAGCTGCAGGTGGCTGAGGAGGCGTCGGTCCTATCGAAGGGGCAGATTCCTCCTTTGGC
ATCTCGGGGGCTAGTGTCTGCTGAGCTACATCAGGAGTCCGGCGGTAGGCGTTGTAGATAGCCGTAATCCACTCGTCCTTCTCGACTTCGTTCTCTGCCT
GCATGTAGAAGCTTGGTTGTCCAGGTGCAGGCTGGAACAGGATGCAGAGCGGATATCCCTGGTCATTCGTCCGGAGCACACTTGTATCCAGCGTAAGCTC
GTAGCAGCGCCGTGGCGCTGTGTCTTGCGGCGTTTTGTAGTACAAGAGCTCGGTGCGAGTCAAGCGGAAGTACCTCCGCCGCCAGTTCGACACGACCCTG
CCCGACCGGCTGCGCTTCATGAGCCATCCCTCCTTGATGTAGCGTTGGTCACTCATCGCGGGGAGACGGCAGCGACTTACTTGTCTCCTCTGTCTTCCTA
GTGCAGTTCTTCTCTACTTTAGCCCGCCGTCACTTGCGCGCTCGCTGTCTTCTTATCTTCTGAGGTGTCCGTGGCCAAAGATCGCGATCACCTTGAAGCG
TCGTCGCGTCCCTCTGCGGACAGCTCGGGCGGTTACTTGATCCCGACCAACTTGTCATGCATTTCGTGCTGCTTATCCGATAAAGCTACGACTTGGCTCC
TTTCTGGAAGAAAAGCGGTGGCGGGAGCTCTAGGGGGAACAGCAACTCGCTTTTGATAGCATTTACCGGTGCATTTCGAGAGGACGTTGGCTCTCGGCCG
GAGCGGTGACTCATGCGTCGCGGACTCGTTGCACCCTTGTTCTGCTTGTAGTAAATCAGTTTCCCCTCAATGCTGGAGCTCGAGCTCTTGGTCGTTGGCA
CCTTCGCATCAGTCCGTACGGCACCAAGTTTGCGACTGCCTCTCAGCGCCGACTCGGCTGCTCTGTCCTCGACGAGTGTATTCTCGTCACACTGCACACT
CGAGTCTACCTTCTCCAGCTTCTTCTCCTCGTCGCTGCATCTCTCCTTCTCAACTCGCTCTACTGCAGTCGCTGGTCGCTGCGTCTGCTGCTTCGTCTCG
TGTTCCACCCGAGGACTCGACGGCTGCGACCTGTTCACTTGTACACCGAGCGCCTTGGTGATGTGCGGGGCCAGCGCCTTCCCGAGACACGAGAGCGTGA
CGGCTCCAACCACGTGCCCCACAACGGCGTTGCGGTGGTCTCGGAGCTCCCACGAGCCGCTGTGGCTCGCCCACTCACAGATGCGCAGCAACCTGCTGCA
GCTCAGCACGTCGTCCTCTAGCCCCACGTTAAGAGGCAGCGGGACAGCTGCAAAGGCTCGCAATCGGGCCCTCCCGCGCTCCTGGAGCAGCAACAACAAC
GTCAGCGGCGCCTCCGCGTCCTGTCGGAGCTCGCGCACGAGCTCGTCCGGCTCCGCTTCGAAGAGACAGGATTTGCCATGCTTGAGTCTCGTCACACAAG
CTTCACTCTGCGTCTGAGAGGCCTTGGAGGGCGTCAGCGGCGTGTCGAACACGACGATCTCGTACTGTAGCAGCTGAAAGCCCAGCACCAGCGCGTTCTC
GAGCTCTGCACAGGACGGTAAGGCCGTTAAACATACTCGGTCCACGTAGAACTGCAGCGAGAACAGCACACAAGCAGGTAGACGGGCAGGAGGTCCACTG
AGCGCGTCGGAGTCGCCGGACGTCACAGAGAGCGCGCCATCTTCAGCGTCCATCGATTAACTGATATAATAGCGGTTATGTTAATGTGTCTGACCTGTCA
ATACCGATACTTGAAGATATCGTAAACCACAGGGCATGCCAATGCATCATCACCTCACATTTCCAGCAGCTTCCGTCATGCTGCGTCGGTTCTCCTCGTC
GGCGGCGCCGCGCATGGTGCAGCAGCGCGTGCAGAGCCAAGTATCGCTGCTGTCCAAGAGCTCCACTGCACCCAGCACGCGCGTCGTGTTCGTGTCTCGT
GCTGCCGCGTCCGACGTGCAGAAGTCGCTGCCGTTCCCCGTGTCCGCTGCTGCGCTGCGCGACTTCCAAGCCAAACCGCTCGAGCGAATGTTCCTGTACC
CAAACGAGGACGACGCCACGCTCCAGACCCAGCGCGTGCTGCTCGTAGGCCTCGGAGACGCCGAGAAGGTGACGCCCAATGTGCTGAGGAACGCCACGCA
CGGCGCCCTCAGCGCGCTCAAGGCCAAGCGCGCCTCGAGCGTCGTGTTGCAGGTGCCCAGTCTGGAGGGTGGAAAGATGGACGCCGCTCGAGTGGTGGAG
CTGATGTCCCAAGCCTCGATGCTGTCTAACTACCAGTTCGACCAGTACCTGACGGAGGCCAAGGACGTCTACGGAGACAGTAAACTGCGCCTGCCACTGG
AGCAGATCTACTTGGACGCGTCGGCTGAGTTCCAGAAGGTCAAGTGATTGCTGGAAGTTTTTTTGTGGTGTTGAAGGAGACTGACAATTGAGTGACATTG
CAGAATGTGGCGGAGCAGGCGACGGTGGGCGAGGAGACCATTTTCGCGCGCAACCTGGGTGCGTACTGATTAAGAGTTGGCCACGTTGTAGTTCTGGGCT
GACTTCGGTGATGCAGGCAATGAGCGCTCGCACATCGTGAACCCGGCATTCATGGAGGAAGTGGCACGTGCTTCGGCCGAGCTCCCCAACATGTCCGTTC
GTGTGCTGCAGCAGGAGGATCTGGAGAAGGAGGGCATGAACATGTTTCTGAGCGTGGGTCAAGCTGGCATCTGCCCTCCTCGTCTGGTTATCCTCGAGTA
TCGTGGCAACCCCGAATCCGACGAGAAGATTGCGCTGGTGGGCAAGGGTGTCACGTTCGACACGGGAGGCCTGAACCTCAAGCCTACGGGTGCTATTGAA
GACATGCATACTGACATGTGTGGCTCGGCTGCTGTGCTGGGAGCTGTCCGTGCCGCTTCGCGCCAGGGTCTTAAGGTGAACATCGTCTGCGCTCTTGCTC
TGGCCGAGAACGCCATCGGATCAAAGGCCGTGAAGCCACTTACGATTGTCAAGTCGCACAAGGGAATCACCGTGGAGAACAACAACACCGATGCTGAGGG
CCGCCTGGTCCTTGGAGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCCCAAGAAGGTTATCGACGTGGCTACTCTGACTGGTGCGTGCATGATCGCT
CTGGGTGAGCACTGCGCTGGTCTGTTCTCCAACTCGATGACCTGGCCAAGAAGCTGCAGGAAAGTGGTACCGAGTGTCACGAGCGTTGCTGGCGCCTGCC
AATCCTCCCTGAGCACACTGCCGCGCTTAAGGGTACCCAGTCGGACTCCCGCAGCACCGGTCGTGTCCGCTACGGAGGCGCCTCCACGGCTGCTGCTTTC
CTGCAGCAGTTTGTTTACGAGGGCGTGGATTGGGCTCACCTTGATATTGCTGGGCCGTCAAATTACAGCTCTGCCAAGTCGTACTTCCCCAAGGGAGCTA
CGGGCTTTGGCGTCCAGCTGCTCTACAGCTACTTGAAGGAGCACGAACAGCACTAGAAGGTGCTATCTGCCGCCGGTTTTGTTGTTACTCAATAGAAATG
GCAAACAGGAAAGGCGTGTTGAAGATGTTAATGGTGGTTAGTGCTCTGTGTACAGATTCCAAACGAAAACGCAGCCATCATCACCTACAGAGACAAGCTG
ACGATCGTCTGGGCTGAAGGCGAGGCCGCGAACATTGCCCGAGTGGCCTACGCCGTCCATGATCAACTGGTTGGTGTTAAAGTCCCAGACTTTCACGAGT
CGATCGTTCCCACCGGTGGCAAACACTTCGAGATTGTGCGCTACAGCGATGCAAGTGGCCTCTTCGTCGTGGGCCTTCTGGATCACGGTCACAGGTGTGT
CGATGCGCAAGTCCCAGTAAGATATGCGCTTTTCCTGGCCAGCACTCAAAACTAGGTGTTGGTCAGCAGACAGCGCCACAGTGTTGATCCCGCCCATGCG
CTGGATGTGACTTGAAATTCTCCGTTCATTGCGCAGATCCCAGCAGAGCAAACTGCGGTCTCGACTGCAAGAGATCACGTGCAGATCGTCGCGATACAGC
GCCAGACTCGTGACTGTCATCGAGTGCTCTTTGAGGTGTGAGACCAAGTCGCGCTTGCGAATATCCCACACGCGTACTTCACCTCCAACCCCCGCGGACA
CGATGAAGCGCTGGTTGTGGCTCAAGACAAGCGCCGTGACTCCACCTGTATGAGCATTATCAATGGACCAGGCCAGGTCACCAGAGTCGCTGCTATGAGA
CCGGATGCAGCCATCAGTCCAACCTGAAAGAAGCACGTCTAGCGAGTACTGGAGAGATGTCGGTGCTCCAGCATCACCAACCATGCAACGGGTTGCCACC
GAGTAGTCGGAGGCATCCCATACTCGAATAGTGCAGTCTCGAGAGATTGTGGCGAATCGGTCGGACACGTCTGGCGCGTACGCTATCTGCACGACAGCGC
TCGAGTGGTTTTCAGACAGCAAGCTAGCCTGGAGACTTCGTTGGGAAGTGCCGAGCGCGAGACGCACGGAGTAAATCCCCCCGGCTTGGGTGCCGGCAAC
AGCCTCATTCTGTGCTGCATTCAGAGCTATACCGACGACGCCGCTGTCTAGGCCAACGTGGCAGGTGTCCACGAAGTCGTGCCCGTAGTGCAAGACACTG
CCATCCCCGCCACCTACAAGAATACCGCCATCGAAGTACAAAATGGAGTTCACGCCGCAGGAACAAGCCGGAACAACCTTGAATAGCTGCCGCGCTTTCA
CACCGACCACGCAAAAATCGCCACTCGAGCTGCCAGCAATGAGGGTCTCACGGTCAGGCGAGAACTGCACGCAGGTGTAATCACGAACGAGAGTCTGCTC
GATTTTGTGCGGCATGAGCTCACCCGTGACAGGATTGAGGACCCAAATCTGCAGCAATCGGTGCCCGACTGTAGCAAATTGGTAGTTGGCCGTGTCGCGG
CGCTTTACGTCACGCGCCATGCCCCCAAAGGCAACCGCTGTGACGATGCTCGACATCTTTTGGTGCGTGGCGCAAATGTTACCTGTCAAAACGTCCCAAA
TGTACAGCCGGGGGCCGTCCTCAGGAACACCAACGGAGCATAACAGTCGCTCGTCATCCGAGAAGGCAAGTGCAGCGATACCTGCGTCGTGCTCAGATAG
TCTAAAAGCTAGCCTGCGGGCTGAATAATCCCACACCAGGATATCTGCACGCCTGCCACGCTCACCCGAGGCTAGGATTCTCCCCGATGGAGACATGGCA
ATGCAGGTCACATTACCCTCATGACCGCGCAAGAAGACCTGGCTGTGCGCGTCTTGGAAGGATGTAAGCAGCACCGAACCACCAGCGGGATACACGTAGT
CTCGGCCTGCAGGGTGATAGTGAATTGCGTTTGGTACGGCGGAGAAGCCAATGGTGTGCTCCAATTCAATCACGGGCGACTGCTGCGGCTGCTTCTCCCG
CCCTCTTGAGCTCGACTTGGTATCCATCAGAGCAGCGCCTTCGTATCCACGCATGTTGTTGCCGCCATCATACTGCATTATGACAGACGCGACTTCTTGG
AGCAATCAGCAATGAGAACTTCCCATAAGGAAGAGCCTCTAGCAACTGCCGACCGTGGAAAAGTAACCACTAAAACTAAACATATATCCCGAAGTTATTT
ACTCAAGCTGTGTCCCAGACTCGAGGAGCCCCGTGGCGCCAACATAACTCAAGCACGTGTAGTACGGAGCCAGGTCGTTCTCGTGCATCCACCGGGCGAC
GTCCAGGCCAATATCCTCCTGTCGGTCGAACAGATTCACTCGCAGGACACCTCGAGCCAGAAACACTCGGGAAGGCAGCTCGAACGTTTGCATCTACAGT
TAGCAGTGGTAAGCATTTCAGTTGTCATACCCAGCTACCGTTAGGATAGTGCGCTCGCACCTTCATGTCCTTGACAATGCTGAACACCATGGACTCGTAG
ACCAAAGAGCCCATCTCTCCGTCTTCTTCCAGCTCGTACAGCGCGAACGACAGCCGCTTGGGCGAGTACGTCGGGCTGCCGGGGTACCAGAACACCCTGT
ACGGGACAATCTGCACACTGTTCACCATGGAGTTTTCCCACAGCGTGTAGTCGAGATAATCCGTGGTCGCGTATCCCCACGTCGAGGCACTGGCGCAACA
CAAACACCAATGAGCTTCAACAAAAGTCCCATCTTCTCGATCCATCACTCGTCTCACCTGCTCCAGTAGCACGGACGGCCTCTCGCACAGCCGCACTCAA
GCTGCAGCCTCTTGGCGATGGCTTCGAACGCCAACGGGTCGTCCACCACCACCGTATTGGCCAGCAGCGCCACACCAACGCCACAGTGCGACTTCGTGAG
CGTGTTCTCCGCCGATTCGTTCGTGTGGTCCACCGACGAGCACTCTACAAGCAACAAACAGTCTTAGATTCCCTTCCTCCTCCTCATCCTCCTCTTAGCA
CCAGGCAGCACCTCGCACTTGACGCAGCAGCGAGAGATCTTCGCCCACGGGGCTCTGAGTTAGCAGCGCCAATCGCTTCCAGTCCGCAGAGCTTCTGGTG
TGGCAGCCAATCGCGTACAGCGCCATACGCCGCGCCAGGAGTTGCCATGTGTCTGTCAGACAACAGTATCCGAGTCAGAAGAAGAAGAAGCACGTTAAAG
AGCCAATTGAGCACGCACCACAGCCCACGATGGTGTCCCGCACGCGGCGGTTCACGGCCTCCAGATGCAGCAGCGACGTGTGGTCCACGAACTGCAGTAT
CGCCGCCAGCATGTCGCTCGGCAGCTCGCACAGCCCCATGTGTGTAGCTTCTGGGCGACAGTTGAACTTCTCAGTGCCCGTACAATGCTAGCTCTCAAAT
TGTCCGTAGGGTGATTTGGACTAAATAAATATGAACGGATATGAAAGGGTATGTTAAGAACACGTCTGAAACCTTCGCAGTGACTTTCACATCTGCCAAG
TTGAAGTTGTTGACAACATGCACAAGCTACATTTCGTGTTTTATCACTCCTTGGCTCTCTCTCTCTCTACATGTACACTTGATCAGTGAAGTCGGACACA
TTGCTGCACGTCTAGTCGTCCCACTGATTGAGCGCCTGGCGGAGCATGCGCTGGAACTGCGATGAGGCGGCACGCTCCTTCTCGATCTCGACCCGGAGAC
GCTTCATCTCGCCCACAGCGCGGTACTTCTGCAGCGGATCGTCGATTAGGCTCAGACTCGAGCCTGCAGACTTGTTCCCAAAGCTTCGCCTAATGCTCTG
CACGGAAACCTTCACGGGTGGCTGCTTCGTGACGATTCGGTCGCGCTTGGGGCGCTGGCTTGAGACGTGGAGCTGCGTCGGCAGTGGAGAGTGTACAGCA
TCCAGAAGACTGGCAACGCTCGAATTGAACCCTCGCCAGTCCGCGGGGTAGTAGATGGCAAAGTCGCTCAGCGTCTCGAAGAAGGTCTCGTAGATCTCCT
CAAAGATCTTTCGCCAAGGCAACAGGACGTCCGCCTCCTCCGGAGTCACTTGATTCGCGCTTCCGTCCACGCTCTGCATCAGACGTTCATGCACCGGGAG
CAGTAAACTGTAAATCCGCTTCTTGAGTTCATACGTCGACACTGCAGTGGAGGCTGGATACGAACGGAACAGCCGATCGACGAAGTCCACGATCTTCTTG
AAGTAGACGTCGCAGAGCTGGTCGCACTGTACAGTGGAAGGCTCGATTGCGATGAAAGTCACTTCTAGCGCTGTCAAAACCGTCCTGATCTCATGCCGCT
TCTCTTGCGAGTTCCAACCGTGCGGGGGGTCCACGACAACAGACTGCAGCTCTGGTGGCGGGTACGCTAGATCCATTACGCCAGACGACAAGATGTCTTC
ACGTACGCGCGGGAAAACCGCACAAATTTGGCTCTGAATACCCACTGACGATTCGTACTGGTTCATCATTGCCTTGACACTACCCTCCAGCAGCTCTCTC
AGACCAACACTCTTCAGATTATGAACGGGGGGAGACAGGGATGCAATCTTGGAAACCACTTGCCTGAACTTCTGGGGAAGAAGCTCACCAGCGTTTACAA
ACTCAACGACAATGTGGACAACTTGCGGGGCAAATTTGCTCTGCACTCGTTCGACACAGCTCTCAAGCGTACTTGTGACAAGAGAGCGCAAGGACCCGAT
TTCGGACGAAGCAAACCCCAACACAAGCACACTCACGCGACACCCTGGTCTCAGTAGTGATAACAAGTCTCCCAGGCGCTGCTCCCAGCTAAAAGAATTG
CCTGCTTGCAGCAATGTACTCAGGTCAACGGGAAGTAGGACCGCGGACGTTGCAGCGAGCTTCTCTCTCTGTACCTCACCACCGTTTCTCTGAGTAAACG
TCGAATCAAGATACCGACAGCACACATCCACGCCCTGGTTGGACTGAAAAATGCGATGGCAGTCATGCTGGGGTGTCGTAGCATCTTGTGTTCCAGCCTT
GACCGCACACCACAAGCCAAATGACGAGGAAGCTCCATCGAGAAGATCCGCAATCACCAATTTCCACGCGATCGATGCTGCACCGGGGTTCACAAGCCGA
AGAGGAGCACAGACCAGTCCTAGGATGTCTTCGGAGCTCCAAAGTGACGATACTTCTGTGTCCGAAAGCGGTGAGTCCCCTTCCGACCTAAACGCTGGCT
TCAGTCGCTTCGTACCAATAGATACAACATTGGTCCCTCTGAACAGCCACTGCACACTGTCTTTTGCCTTTTGATGAGGTCGCACTTGCCGAAGTTTTGC
TGCATCGATGGCAACTGGGCCAGGGCCGGTACGTGAATCTTGAACGTACTTCTTCCAGAGATGCAATCTCAGTTTCAGGACGGCGAGCCTTTGCATTTCG
GCGCGACGCACCCGCTTTCTTTCGGCCCGCTCTTTCGCCAATTGCGCTTGTCGCTGCGCTTCAAGCAGTGCCTCGCGTTCCTGGCGAGCTCGTGCCTCCG
CTAGTTCTTGCTGGCGACGTCGCTCAAACTCTTCTGCAGCCTTCTGCCGAATTTCTTCTTGCCGTTTCTCTTCTTGCCGGCGTCGCTCGTCCTCGACAGC
CTTTATCCTAAGAGCTTCCGCTCGCTGCAGTGCTTCAAGCCTTTGCTGTTCTGCCTCACGCGCAACTTCTTCGGCACGTCTGCGCTGCTCTTCGAGTTCA
CGCTTCTTCTTTTGTTCCCGTAGTTGAGCTTCGAGTTCTTCTTGCTGTCGCTTTGCTTTCTCGGCCTGTTTTTTTGCTTGAGCGCGTGCAACAGCTTCCT
TTTCCGCGTGTTCTTCACTTTGAGCTGCTTTCTCCACCGCATCCTTCTTAGCTTGATCTTGGCGCACCTTTTCTTCCTTCGCTTTCTCTAGTTCTCGCAT
CCGCTCCAGCATAGCTTGCTTCTTCTGTTCAAGCTCCCATTTTCTCTGCGCAATCACATCGAGATCGTGCTTTTTGTGATCGGTTTCTGCAGGCTGGTAC
TGAGTATTTCCGAAGCTCACAGAGATGTTTGAAGGCGTTGGTGGAGCACTCGCTGGAGGCGCCGCTGGTGCTCCGTCATTGTAATCAACAAAATAAGAGT
AGTCGTCCTCATACGCAGGTCGATTCGGATACAGCCTTGCTTGCTCCTCTCGCTCGGAGTCTTGGATCAGCTTACTAAGCGCTGGGTATTCATCGCGTGC
GTATTCGGTCACACCGCGGCAGATATCTCGCCGAAGGTAGTTGCTGCATATATCAAAAGATTAACTACGGAGACACTTCGCAGCCACAAAACTAAATAAT
CCGTACCCTTGCTTCATTCCAACGTAAATCTTGGAACTTCGAATCTTCTGGGGTGTATTGTTCCGCCGTAGTTGCGCATCTGCACCATCGGCATCATATA
ACCATAAGCACAAATGCCACCAATCGCAAGCCTAATAATCCATAATGTACCTGTCTCGAAATCGCCACCGAACTTCACAATCACTGCGCTGTCGTCACCA
GTTCCAGGCCTGCCAGCTATCCTCAAGCCATGCTCTTGGCACACTGAGTAGGCGTGCTCCATGTCATCAAAGCACAGCAATTCAACCAAATCCTCTAATG
GATAGACCTGGCTACGATAAGCCCGGTTCATACGAAGCAGAGCTGATGACCGGGCATTGGGGATGTACCGAAACAGTAAACATGACTGCAGGTAGGTTGC
TTGACGAAGCAGCGAGAAAAACTGGAAGTAATCACCCGTGTGCCGAGCAACAAACACGCGCATCGCGAACTTGATGTGTGGGCTCTCCAAGATATGATGC
GGGAGAACCTTAACATACTTCAGCACATCCATACCGCGGCCATTGTCCAGTGCACACAGGATAAAGTACGCACGACATTCTGCCTCAAATGGACTCAAGT
ACGCGGGATCTCCAACCTTGCGACTTTCATCATACAACTCGTTGAGCGACTTGAGAGTTTGGCCAAGCTGCTCCATATTCTGCTGCGCCACAAAGCTTGG
TGTCTCGATGAGTTCGTGCTCACTGAGCACGTGGTATCGCGCAATACGCTCATGGATGTCGAGAGCGATGGGGTGTACACGTCCTCCAGCGCCGCGGTAA
TTCTGCAACACGAAGTCTTTTCGAATCATTCGAAACCGATCCCAACAGAAGTTATACAACTCGATCGGGCCCGGAACTCGGGGCTGCTGAAAACGTGGAT
CCTCGCCACATTGGTCCAAGTCCATAATTTCCTGCTCGATGTAAAGTTGAGTGCGTCGAAGAACTCCAGGAGGGCGGATTTCCTCTGGAATATCCAGCTT
ATGATCAGCTGAACTGCGTTGGAAGCGCTTGATAATCCTCTCGCGTTCAGTTCCTGGTTGGTTGGGGAAACACTTTTCGAAGACACTCAGCTCATCCACC
CGAATGTGCAGCTCCCGTTCTGCTGGGCTACACATGTCAGCGCAAAGTCCATTCAGATTAGTAGCGGCTGAAAGTTCTGCTTTGCTGCTTTCTTCGGTGG
AGGCCGCAGAAGGCATGGGGGCGTATGAAGTGTCTTCATCGCTCGTACTCGGCGTTTTCTTCTTTGGCCGAGATTGTCGCTGCTTCCCATGCTTTTCATT
AGTTGGGCTTACCTTAGGCGCCTTAGCAGCACCAAAAGCGTCTCCTCCAGCAGGAAAGTTTCGACTTGACTTAGACTGTTGTCCAACGAAGGGGTTAGCA
TCGCGTTCTCCCGAGACACCAGCTTGTTTTCCTTTCTGGAACGGCGATTTCTTTGCGCCACTCATTCGCGCCTCCATGGAGACCATCTTGTCTGAATTTC
CAAATCCTCCTGCGGATACGTCTGAACCAAACGTTGGCGTAGTCTGTCGTCTCTTATCGGTGACACCACCGAACGTGGTCGCAGGAGGGCTGCCAGCAGG
AGAGGGTTTCCCGAACGCAGGAGACCTAGAGCTATTACTACCCGCAGCTCCGCCAAAACTTGTATGAATAGCCGGAGCATTTGGTGCACCTCTTCCATTA
CCCGCCGTCGCAAAATGGTTGTCCGATAGCGAGGAAGATGCAGTGTTTGGGGTGATTTGCTTTTTTCGCACTCTCGCACCAGATGCTTGGCTTCCGAAGG
AAGTCCCTGGCGTCGACACTGGTGCCGGTGCTGCTGTACGACCCGACCCAAAACCATTCGAATTCTGCGAGAATGATCCCTGTCCACGCTTGGGCGTCGG
CGCCCCAAAAGTAGTCTGTCCTGCACCTGGCGATGACAATGGTGCCGGTGCTGCTGTGCCACCCGATCCGAATCCGTTCGCGTCTTGCGAAAAGGATCTC
TGTCCGCGCCTGGGTGCCGACGCCCCAAAAGTAGTCTGTCCTGCACCGAATCCATTGTCGTTTCCTCCAAACGCTGCACTGCTTCCACCGAAAGATGCCG
ATCCATTGCCACCAAACGCAGTCTTCGGTGCATTTCCACTATATCCAGTCTCTCGATTCTTGGGCTTTCCACCTGTAGACGACGAAAATCCAAACGTCGT
GTGTGCACCCGGTAACGTAGAAGAAGTCGACACGCTATTCTGTCCAAACGTAGTCCCTGCACTATTGTGTGCCTTGTTGTTGTTGTTGTTGTTGGTTTTC
TTCTGTCCAAACGGGTTTCCACCGGTCGAAGTGGCTCCAAACCCGCCCGACGGAGCTCCAGCCATTCCTCCGGGAGGAAGTGGGGGCTGATGTCCGAAGC
CTCTGCCCGGAGCCCCAGCCATTCCACCAGGAGGCAGTGGAGGTTGATTGATAAAGCCGGAGCTCTGTCCGAACGCGGTCTGGGCCACTGGAGCGTTTGC
ATTGGACTGGAACTGGTTCATCGTTGAGGATCCTGGACACGCCAAGGGCACCGATCAATACCTAGAGACGCCTAGAGACGCACACACAACGAGAGCAGAG
CAAAGCGCGTAACCGTAGCCATGTAACCTCCGTACCTTGACTCTGCGCGAACGGGTTACTGCTCTGCGCCGCGAAGCCGCCGCCTCGATCTGCACAGAGT
GGACACAACGTATCAGCTTGTAACTCGGGAATCACGTGGCCAATGGAAGCGCAAGAAGGTGGAGAATAAAAACGAAAAAGTGGAGAACGCACTTCCGGAG
CTGAACATGCCGGCGTCGTCCCGAGAGCCGCTGCGTCGTCGCTCGCAGGTGTCGTCTGCGGTTCCTGGGCCCGTTGGGAAGCTGAACAGGGGGAGATGCA
GCTGCGGTACCATGTACCGTTATGCGGTCGTGTGGCCCACCTTATCTGGAAATCCTAGTTCAGGCTAATGCGGTCTAGGTTAGGCAAGATGCTGCGATCT
GATTGGCTGTGAGGTCAAGGCATAGTGAGCCCAAGTGAATGTCAGGACTGGAGAGCCTTGCGCGTTGGGGAACCACCAATTCTCGGGCGCTGGCTCCGCC
TGCGATTGTTGGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAACTACGCCCCATGACGGCGGCAATGACCAGCGACTC
ACACTGCGCCTTCCTCTCTCTGTGTATCGTAGTTCAAGATGGTGAAGCACAACAACGTTATCCCCAATGGCCACTTCCACAAGTACTGGGAGTCCCGAAT
CAAGACTTGGTTCGACCAGGTAAGACAACAGCCATGACGAAACTTTTACAACCCCCAGCGGCTAGATGCACACACACCCCATTAGCTTCTTCAATCCGTC
TGCCACCATTGGACAAAACGTCAGAGAACGAGAACAGGTCGACTGGAAGGGGACAGACAGTGGATCTCTCTAGCGGAGACGGATTCAATGGGCGTGTGGC
GCTTTAGCTGCTGGCTGCAGACAACTACGAAGGATCTACGTACTGATACAAGTGACATTATGTTGTGACCTACCAATAGGCTGCCAAGAAGAAAACCCGC
CGTCTGGCACGTAAGGCCAAGGCTGCTGCCATTGCCCCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCACTGCCCCACGATCAAGTACGGCTCCA
AGGTCCGTGCTGGCAAGGGTTTCACGCTGGAGGAGCTGAAGGAGGCTGGCATCAACCGCAAGCAGGCCATCAGCATCGGCATTGCCGTGGACTTCCGTCG
CACGAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCGTGAACAAGCCC
AAGAACGGCGACTCGTCCCCGGAGGAGACCAAGAACGCCGTGCAGTACACGGGCGCGATCCTCCCGATCACCCGCTCGAGCGTCAAGTCGACGACGGCTG
TCATCACGCCCGAGATGAAGGAGAAGAGCGTCTTCACGCAGCTGCGTGTGGCTCGCGCCGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTGGCTGA
CAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACACGTGCTGGCTTGCTCTCTCAGCCGACTTGCTGTTGAGAGGGTGGGCAACTCCCTAAGGTCTTT
TGCGGAACGTTGGAACACAATATATCGCGCATCAAAAAAGCTCGGTCTTCTTTTTTGCATATTTGTGTTTGAGGCTTCGTGTTGCAGTTTAAAGGCAATA
TCGTTTAGACTTGGTATTTGACCACCTAAATCTACGTGTTCACACTCTTACGTCGGCATACGCCTCTGGTTCCGACAGTAATGGTTGTTGCTCTGGTTCG
TCGGACAGCATGATGGACTTGTACTTCACTGGTCTTCCCACCAAACTGTTGTTTTCTGAGGTGTCAACCTTCTCGGGCAGCACGCAAAGGAACACCAAGA
CGAGCAACTGGCCGACAGACGCAATCACCACGACCAGCCACAGATGGCTCCAGTCCACAACCTTTGTGGTCGGGTCGGGAACAATTCCGAGTGCCAACAC
CAGTAGTGACGTAAGAACTCCCGACACAACGCCGCCGAAGTCCATGAACGATAGGTACAATGCGTACGTCAAACCTTGAACGTCCGAGTTTGAAGGGCAG
TAGTACGTGGCTACTACTAGCAACTGCAACAGCGCGAACTCCGAGGTGAACGAGGTGATAAAAGACTCCACTGTGCCAAACGTACACACTGAGACGGGAA
GCTGCACGACAGGTGGAGCTAGCAACAGTCGTGGCAGACCAGCAGCAACAGAGCACACTGTAGAGAGCAAAAAGACGCTTCGAACACTCCGGTTGGTGCA
CCACTTGGCGTACGACAGACACGACAGGAAGCGCCCGACCATGCCAGCGAGGTACATGTACTGCAAGCACTCGTGCTCGTCTTCAAGGAGCGAGAACGTG
TACTGGTACCATATCGTTCCATCGCCAGGCAGTGCATTGCACAAGAAGAAGAAGAGCATGGGCGGCAGCACCGGTCGCATGAGTTCCCATTTGTGCTGAA
GTTCGCGCTTAAACGGCAGCCACCACGAGTTCAGCAAACTTGTCGATGCAACAAATTCAACAGGTTCCGATTCTCTGTCGTCGTGTAGCTCATCCACGGG
TGTCTCCTTCAATCCAACGAGACACACTCCCGCCGCTGCTAGCGGCAGCATACTGGTCCATCCAATAACCTGCTGCGGCGTGATGCTCTTGTCTCGATAC
ACTGGGATGCCCAGCACCAAGGCTGCAATCGACGCCACGTTCTTGACGCCATTGGCCAATGACTGCACGTGTGCACTGCTTCTACTGGAGGCATCTCCCG
TCGTCAGGTCCACCAACAAGACGCCGAGCATAATCTGCGCGAAGGCTTCGGCCACGGCGTCTACGAGCTTCACAGCGAAAGCGCCAGCGATCGAGTGCAC
GTACGTGGCCGTCAGCACCAATGAGACTGCGGTAACGACCTCGCACAGAACGATGTACGACTTGCGGTGGTACCCGAAAAGCGGGAGGCTGTCGGACAGC
AGGCCGTACAGCGGCTTGAGGTTCCAGGGGAAGAACGTGACCGAGTAGTAGAGCGTCGTGGTGGCTGGCGGCATGTGAATGACATCGAAGAGCCACATGC
CGTACGCTGTCATGGGGAACGACATGATGAACGAGTGCAGGAAGTAGAGCGCCAGCAGCGCCACCGGCACTCGCGTCATGGCCTCTCTTCCAGTCTCAGC
ATCTGATACGCATGGCTTCAAGCGGCACTGTAAACGACACAATAACAATCATGTTGTATCCAACAGTAATTTCTGGCGTTTGATTGGTGTGGACGAATAA
ACGTATTTGATTCGTTGAAATACAATGCCATGCAAACTGTTGTCATTGGCAGAAAACCATTACTGCCACGAGCACCAACGCACTAGACTATCGCCTGGCG
GAGGACGCTCGAAGATGGCGCGCGACGAGTTCAACATCGACGAGGCCGATGACTTCGACGACGGCACGCGAGCGGTGGTGCACGCGGATGCGGCGTCGGA
TTCCGATGCAGAGGTGCAGGATGCAACGCGGCTGCGCTCGTCCCGCAAACAGCGACTGCAGGCAGAGCGCAAAGGAGGCAAGCAGCGCGAGAAGGCGTCG
GCTCTGCGCGTCAAGAACTGGGACGCGCTGGAGAGCGCCGAGTACGCGGGCAAAGTGGTGAAGCGCAAGGAACTAACGGAGGATGGACTGGAGTCACCAG
ACGAAGATGCAATGGCCGAGTGGTCCGATGCTGAGCCGTTCGGAGCGTCGGAAGATGAAGAAGAAGAGGTCGAAGAAGAGGAGGTTGAAGAAGAAGAAGA
AGAAGAGAGCGAAGGAGATGAAGAGGACAAGAGCGCGGAGATGCTCATCCGCGGCTTCCAGAAGGAGGATTCGGCACGGCTCATGAGCGCGCAGGACAGC
GAGAAGGTCGTGGAGAAGGCGCAGCACGTGAGGAACCAGAAGATCATCTGGGAGCGCTGTTTGGAAGTACAGATCTACGCCAAGCGTCTGCTGACAACGG
CAAAGGATGTAACGGCACATGAGACGGACGGAGAGACGACGGATGAGGAAGCAGCTACGAAGACTAAGGAGGAGGTGGTTGCTCAGCTGTACAAGAGCAT
CGACGCCGTGTCTGCACTGCAGGAGAAACTGTGCAATGTACCTGAGCTGAGTGCGGGTGACGCACCCACCAAGAAACGCAAGCGCACGTGCGATGACTTA
TGGCAGGAGATCAATGCTAACAACCGCACGATCCTTCCTCAGTACAACGAGATTCTCAACACATACACGCGCAAGACCGACCTAGCGGCAGGAGGCAAGA
ACAGCCAGGCGAAGAAGTTCAAGGCTGTGAACCAAGATATCCTTGCGCAAGTAGAGTCGGTGCTCGTGGATCCCCAGCGAGTCAAGCGAAAGGCACATGC
GCCGCTTGATGTACCAGAGGACGAGGCCACAGACGGAGCTCAAGACCTGCTGGATGAGCTCATGTACGACGACTCTGATTTTTACCAGCAGCTTCTGAAG
GAGTTTATCGAGAGTGGTGGAGGTGGCGCTGGGCAGGACGCCATGGTGAGGCGCACTCACCGCAAGAAAAAGAAAATCGTGAACCGCAAGGCGAGCAAGG
GCCGCCAATTGCGCTACACGGTGCACCCCAAGCTCGAGAACTTTATGTTCCCGGAGCCTTACCCCAAGCCGGAGATGGACGTGGACGAGCTTTTCCGCTC
GCTCTTCGGCCAGGTTCGGCAGTAGAAAGCTTGACATTGACATGCTGGCCATCGAGAAATAGATTGATTTTGATCGGAATGTGGGTGCTTGTAGGCGTGT
TAGTGTTTCCTACGTACTTACCGCGGTAAATACCCTTCTGCCTACGCCATACGCCGGCGCGCTGCGTCTTGTTCAAGGAAGACATCGCATGTTTCCTTAT
AGCACATCGTCTTCTTCTTCCTCTTCCTTTTCGCCTGATAAGTACACTTCCTTGACCTTCGCTACGGTTGCCTCCAAATCCCGGAGACGCAGTTCATTGA
CTCCGCTGGCGCCAATCTTCTTGACGATGCCCACCAACGTGGCTGCCTTCTCAGCGACGTGCACCACAGCCAATGCTCGGATCTTCTTAGCTCGAGTAGC
ATTCTCCAACGACCGGAATTCCTCATCGGCTAAATCCATCGACGCATCAGCAAGCACTATTGTGGAGTCAAGGAGCGCAGTGCCATGCTCCTCAAAGCGC
TCAGGGATGTTGAGCTCGTGCAGTTGCCGTACTTCCGAGGCATACGAGCCGCTCTTAAATACTTTGTGTTTGAGTTTCACTGTGTCCTTCAGCAGCTGTG
TGAACTTGTCGATCAGTTCTGGCTTACCCTTGGCGATTGCACGCATTGTTGCAGGAGCGTTTAGAATCTGTGCGCGCTTTGCGATCAACTGGCCAGCATC
GCGTTCCAGGAACGAAAGCCCCCACAGACGTCCGTACGCCTTGCCAGCATCTAACCGCTCCTGTTCTGAGTAGTACCAGTCCCGCGTTTCCTTGTTCTTG
ATGAGCAGACGCGATGACCAGGACTGGACGGAGTCAGTTCCGAGCGCAAGCCCATATTCCTCCAACTTCGGAGCGATTGCTTTGTAGAAGGTGATCGCTA
CTTCGTCGGTGGACAGCTTCGTAGTCAGTAGTTCCGCAACCAAGCGGTTGACTTCCTCTCGATTGTCAACGAGCTTTTTGTTGCTCTCCTTTCGCGCTTT
CTTCTCGAGCTGCTCGATCATACTCATACCAACGGGTCCCTTTGATTGCTGGGATTCATCACCAAAGATGTCGTCGATAGCACTTTCCGCGGCGGCCAGC
TCCTGCGCCATCTGATCCTCTACTGACCGCGGTGGCATGCCATCTATTGTAGCACCACCGCTGCTCCCGCGACCACGCGCACCGTTCGCCAAGCCACCAC
CATTTGACACTGTATTGATCCCGTGAACACACGCACACATCAGTATGCAAGCAAACGACAACAACGCACCTAACAGCCAACTTACCTTGTTGGATAATCT
GCTGGTGTTGCATTAGAATACTGAAGAGCTGCTCCATTGAGACAGGGCCAGTTGGTGAGGCTGGCGCTTGAGCAGGCGGCTGATAATGCAAGCACGATTT
AGAACTACGTAAACATTGACAAGACAAACAAGAAAGCTGTACCAAAGTAGGTCACTTACACCAGGGTCGTTGGGAGAAACGGCATCTGGACGGTCAAGTA
GATCGGGATCCATCTCGTCCGCCTTCATTTTGAGCTTGATCTGCTCGTCAGGCATGCCCATTTGCCGCAGTTTGAAGTACTTCTTGAGCTGTGGATCATC
TTTTACAAGAAGTGGTTCGTACGGGACAACAGGCGCTGGAGCAGACATTGAGGGCCAGCTGAAGCCGCCACTAGATCCTTGGGGTGGAGACAGCGGTGCC
ATTCCATTCGACGGATATCCTGACGAGATTTGCAACGGTGGCTGCAAGAACAGAAAACATAGCCAAAACGGTCAGATAACACATGCTTGATGCTTCACAA
CAGTGGACAAACTCACGCCAAGGTCGTTCGGTGACACTTGATTCGGGTTGTCCAGCAACTTGGGGTCCACGCCGTCGGCCTCCATTTTTATCTTGATCTG
ACCCATGGGCATGTCCATACTCTTCAACTTGAAGTACTTCTTGAATGCAGGATCGTCCGCCACGGTCATCGGGATGTAAGCACCCTTCTCTGGCTGTAAA
AATAATAAATAAACACCAGACCCTGCATAAGTCCTCGTGCCAACAAGACAACCTCGTTTTGTACGTACGCCCGGGTCGTTCGGCGACACAGCGTCGGGTG
TATCCAACAGTGACGGATTGACGCCGTCCGCCTCCATCTTCGTCTTGATCTGATCCACCGGCATGTCCATTCCCTTGAGCTTGAAGTACTTGGCAAAGTC
GGGGTCGTCCTTCACCAGCAGTGCAGTGTACACACTCCTCGCGCCTCCTGCGTACGTCTGCGTCTTCTTCTCCAGCTCGTTGAGCTTTTCGTGCAGCGCC
TTGATCTCCTTCAAGCTGGCGCCGGACGCTCCTCTCTCTCTGCTCACTGCTCCGTTCTTCTTGTCGGCCATGAGCTGGGAGATCTGTCTCTGTAGCTTGT
CAATGGACGAGCTGGTCGTCACGACGTCCGCTTTGGACGCCAGCTCCAGCAGCTTCTTGACCTGCTGGGGCGTGAGGCCAGGGACTCCCATGGTCGCGAG
CGGAGCGTGGGCCACGTCTTCGCTCTCAGAGTCGCTCTCCTCCTCCTCCTCGTCCGACTCGTCCTCTTCCTCCTCATTGGCTGCCTCCTTCTCCATGCGC
CGCTTGATGCAGAGGTTGCGGTGCGCTCTCGCATGTCTTCTCTTGCATGTCTAGTCATATTCCACATAGTCATATTCCATCCTCAGTTAGTGATAATCCA
CCGTTTCTTAGTCGGAATATATGCTGACGTACTTCGCTGCAGTAGGACGCTTCGTTGCAGATGGTGCAGGGTAGCGACGCGTTGGGCGTCGCACAGTAGG
CGCAGTCCTCGCCCGCCGACACCGCGAAGCCGCCTGCCAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATGGCGAGTGATTGACGCGAGGC
TTCTTGAGGACTGCTGCTTTTAGAAACACCAGAAACGGGTCTGATGGGTTTGATGTCTCGGGACCCGAAACTTTGGCTGATTGTCCACAAGTAGAACGTG
CCTCGGCCATCCTCTCATCAACAGGAATCCAGTTGATCCAGTCTTCTGGATAGCCGCAGATGGAGTGAAGCCTACCAGAATCAGATCGATTGGAATTCGT
CACTTCAACTTGCCTTTTGCCAAATCTTGTGAAAAGAGTGTCATGTGTATTGCTCTGCTACAATATGAATAAATAGTGCGGCGTGCGGCCATGCCACTAC
GCTCTTCGACCGAGCGTAGTTGGCCGCGTGCGGCTTATATAGATAGGGTTTGCCTTGAAAGGAGAGCTGCGTGTCGTCCTCCTCTAGGCTGCAGCTCGGG
ACAGGCGACGCTGCGAGAGCATGCGCACCATGTCCGAAGACTTGTCGGTCTCGCTAATGTTGAGCACGTAGTCTGATCCCACTTGCTCGTTGGTGACAAA
GCCCGAGAACCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCCGCGATCATCATGGCGTCGCTGTCGTTCTTGGTGCGCTTCTCGGGGTCG
GCGTCGTGGCGCAGCAGAAACTCGGAGATCGCCAACGAGCCCAGTTTGGCCGCAAAGTGCAGCGGGGTGATGCCACTCGCTGTCATGACATTCACGTTCG
CGCCGTGCTCGACGAGCAGCGAGACGATCTCGATGTTCTGCGAGACAATGGCGGCATGAAGAGGGTAAGTGCCGCGCTTGCTGCAAGCGGATACCTTGGC
ACCAGCCTCCAGTAGCAGCTTCACGACGTCGACGCATCCGTTGCGGCACGCTGCGATGAGCGGGGTCACACCAGCATCGTTCGCCTTGTTGACGTCTGCG
CCCTCGTCCAGCAACAGAGACACAACGTCTGTGCGTCCCATGCGGGCCGCGATGTGCAGACACGAAGACCCATCGGCCATGGCCGTGTTGGCGTCGGCGT
AATTGAACAAGATGAGCTGCACGGCGTACAAGTGGCCGATACGGCACGCCACATACAGACAAAGCTCCCAGCGGCGAGCCTGGGTGAGCTCGGGTGAGCG
CAACTCCTCGATGTCGTTGGCGAACTGGTTCAGTACGTGCTCGCAGAACTCCTCCATGAACGAGTGCATGGTGTGGACGCGCACGGCCTTCACTTGCAGG
GACGGGAGCGTCATGCGGTCAGGTTCTACGTCGTTCTCTTCACTTGACGTAGGCGTCGAGTCCTCTTCCATTCGAGGCTCGACAGCACGTGGAGCACCAA
GATGCACCTCACTTAGCTCAGGAACGCCTTCCTCTTCTTCATCTTGGCTAAGCATCTGCTCGGCGCATTGCTGCCTCCACCCGTTCAAGGCGAGCGGGCG
GTGCAGCGCCGCCGAGGCGTCGGTGGGGAAGTGCTCATTGGCGCCCAGGAAGTTGGCATACGTCTTGAGCACGAAACAGCTGCCGTCCTGCAGCTTGTCC
CGCAATGTGGCACTGGTGAAGGTGCCAAAGAAGTCGTGTAAAAGCGTCACGAAGGCCGCGAACGCATCACGGCGCTCATTAACGACGGCGTGGTCGAGTC
CCGAGAGCTTGGAGCGCAGTGAGCAGCGCGACGGGAACGGGAACGACCGCAGCAGCGGGTACAGGCCGTCAAACTCGCAGTGGTCCTTGGCGCAATGGCA
TTTGTGCGCGAGGCTGAGCGTCAGGTGGTGGCGGTGCTTCGGCTCGTTCACACGCTCCCGCAGCGTCTTCCACAGACGGCGGAACTGTGAGTACGAGCGT
AGCGTGGTGCACACGCCGTTGGCATCTCGCTTGGTGAGCTTGAGTGCGAAGAAGACTTTGCCGTCCGTGACCTGGTAGGAGGGCACGGCCACGTCGTACT
TGTGGACCCAGCTCATGTGTTTGTCGAAGGTGGTGTCTTGGCGAGTGGCTGCGACGGAATTGGCGACAGGGTTGCTGGCTTCTAAAGGTGTTCGGATGGT
TCTCGGTGCGCCGGTCTTTCGAGATACGACCGAGCTAGTAATAGCGAGGGCCGGAAATAGAGTCCCGAGGGGATTCGCTGGGTTGGTACGAGCTCGCTGC
AAGCAGCAGAGCTACGTGGATCCTTTTCCGCGTTGGAAAAATGGGAATTGGTCCAGTGCCGGACAAGCGCCAAGATGCGGCGTGAACTCGACAAGCATCG
TCGTTGATGAAAGTCACACGCGGTCTGATCTACCAATGGGCGCGCGTCAAATCCCCTATTTTGGCCAATGGCCATGCGGTCCCCCCTTTCACAACCGAAC
GCAGAAAATACGCGTGTTTCTGCCCCGGCATTAGCTTGGCTGGCATTCATCCACGCTTGACGATTTGCACCGTCGGCGCGGTCTCCGATGTTACTACGCG
TCACCAACACTGGTGCGAGCTGACCAGGCCGCCGCAGTCTGCATGGAACGACGTGTGCAATGCAGAACACAATTCCCACTGCAATCTTCCGTGTCACTTC
CCATTGCTGCACGCAGCCCACAGCCCTGGGGAACGTACACCGTGAAGTTTGGGGACGTTACCAATTCGGGGGAGCACAGCTAAGAATTGTCAAATGCTCG
TTGCGATCGCGACAGCCGATGGATTTTCGCAGCGTCCCCAGCTCGTGGGCTTTGTGCACGTGGGGTCAGCAGGGTTGAGCCCCCACTGGTCAGCAAAGTT
GAAGCGAGCAGCATCAGCGAGATCCGTCCGGTGCACCATGCAGAGCTCCGAGGCCGTGAACTGGGCCTGCAGTAGTTGCAGTGCCTCAACATCCAAGGCA
GTGCTGGTGATGCGAGCCCCCCGGGTGATCGCAATTGTAGCCCCACCGCTAACGACATTCAATTCCTTAGCGGTGGATTTTCATGAGCACCATCCGAGCG
TTCGATCGTCCGTGCGACTTGTAAAAAATTCGTATTGCCGCAGACGAACGGCAGTGTCGTGTTTGTGCTTGCAGAGGATTCCGACACAACGTAAAGGCAG
GCTTTGCACGGACACTTGGTCGACGTACATGTACAAGCGACTCCACCTACAGGGTATCCTTGAAGCGGAGGTGTTAGCCAATGCAGTGATGCTGTAGAGT
TACAATCAAAACGGCGGACCAAAAGAGCGGTTTACAATCAAAGTCGCTCGAATGACCTTCTCCATGTAGCTCTTGTGTTTCACCAGGAAATGAGAGAGGG
GCGAATCCTAGCTTTGGCGCACAATCGGTATTGAACTTCACCTTCAATTCGGAGAACTCTTGTCATAGCTCCAGTTGAAGTTCGCAGCAGTTGGCAACTT
GAGCTGCTTCAAGCTTTCGCTGCCTTCAAGAAGTCTTGCCATAAGTTGCTCGCTCGGCTTAACTGCTTCCTGTATTGTGGCTTCTGCTCCATCGTGCTGG
TGACTTCGAGCTCACAAGTGCCAAGCTACTGGTCGCGTCTCTTCAAACATTCGAGATCCCTCATGGGAAGATTGGTAGCTGCGGTATGCTGCGCCATTGC
TACGACTGCCGTGATCCACACAACCGAGGCGCTCGCTTGCAATGCTGGCACGTATTTTGACGGCACCAAGTGTTCGCGATGCCCCGGAGGCACCTTCGGC
TCCACACCAGGACTCACTTCATCGTCGTGCTCCGGACAGTGTACGGGTGGGTTCGTTTGCCCCGAGGGGTCGACCTCACCACGAGAAAAGCCTTGCGGCA
CCTCCACCTACTACTGCCCCGCAGGGAGTGGGGAGCGTCGGAGGGTAGACACGGGATACTACACAATCACGTTTCCAACCGATCAATACAGCTCGAAAAG
TGGTGCAGGACAGCAAATACGCTGCGAGAAGGGATACTACTGCGTCTTCGGGATCCGCCGAGCCTGTCCTGCTGGGGTGTTTGGTGAATCCACGAGACTC
ACAACCCCAGCATGCTCTGCTCCGTGTCTGATGGGGTCGTACTGCCCCGAGGCAACATCCGTGCCGATCCCATGTCCCGCTGGAACCTATGGGGGTGAAC
TTGGTCTAACCAATGCTCGATGCAGCGGACTCTGCCCAATCGGGCACTACTGGTACGTTTTTCAACTTGCAGCGTGTTGATACACTGATATTTACTGATT
ACTTTGCTTGGAACAGTGAGAAGGGGACAATCGTTCCGGTCGCTTGCCCTATTGGGATCTATGGAGCTACACAGGGTCTCATGACTCAAGCATGCTCGAG
TACATGTTCTCCAGTCAATGGTGTGCTTTCGTGCCTTCCTTCACCATGCCCACCAGGGTTTTACTGCCCGCTTGCGGCAACAGTGCCCTTGGAATGTGGA
GCAGTGAGTCAGTTTTGCCCCAAAGGCTCTCCACTGCCAACCACTGCAACTCCAGGATACTACACGACCTGGAAGGCGTACTGGGGGACGACCGCGACAG
GAGAGCAACTAGCCCTGCAGTATGTTGAAGGCAGCCAACTTGCCGTTCGGAACCAAACCACTCGATCAGATCAGCACATTTGCGAAAAGGGGTCATTCTG
CATTGGTGGCGTCAAAAGGCTTTGTCCTGCTGGAACTTACGGTGACAGCGAAGGTTTGCCGACTGCAACTTGCACCGCGCCATGCCCTGCTGGCTACTTT
TGGTAGGGACGTCAACGTCCCCGCATTCTTTCATATCGTCGTGGTCTAACGGATCTTCCCGTGTTTACTTTCAGTCCGGTAGGAACGGCAAACTACAAAC
TGCAGCCGTGTACGTCGCGGGCATCATTTTGCCGCCAAGGCTCGTCAGTTCCCATTGCTGTCGCCACTGGGTACTTCACAGTCGCAACACAAGCAGGGCT
TCGACCAGACGAAACAATATGCCCAGCTGGAAGCTATTGCACCGCTGGTGTTCAATATCTGTGTCCTGAAGGCACTTACGGAGCCACGCCCGGTCTCGCG
ACCAAGACGTGCACGGGCAAATGCCAGGATGGATACGTCTGTCCACGTGGGTCAACGTCAGCGATGCAATCACCTTGCCCGGCAGGATCGTACTCGCGAA
ATGGCAAAGTCTGTGCAGCCTGCTCTCCTGGGTACTGGTGCGGTGTTGCATCTCCGGACCCCCAGCAACACGCCTGTGGAGCTGACAATACGTTCTGTCC
TCTGGGGTCGCCAGCTGCCCAACTGGTGCTTGATGGCTATTACGCTGTGGGACAGCAACTTAGTACACACGCGTCGGAGGCGTTGTGTGTACTTCGCGAT
GCCCCCCATCTTCCACAGTGTCCTACAAGAACTATAGGAGTGAACGGTAACCTTTAAC