Description :
From Genome Similarity Track
Location :
Scaffold_55:231931- 233466
Sequence
1535 bases(100 bases per row)
CCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATC
TGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACCAGCTCTTCTATTG
CCCCCCTACGAAGAGAGTCAACAAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGC
TTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAAGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTG
GATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCC
CCTCGTTGCCCAAGTCGCTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGC
GCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGAGCCAGGCTTTATGTCTGATTTCT
TTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATACCGTCCCCAAGCTAACGGGTCGGCAGAGCGCATGGTGCAGACGATCAC
GAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATC
CGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATC
CAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATTCCAAGTGAACGAACGGCTGCGGAGTGCGATACAGGGCCGAGCGGATCGACA
CAACGAAGATGCCCGTCCACATCAAATTCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTA
TGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTAT
CCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCTGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCATCCTACCGGA
AGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGT
GAATTTCTGGTGTATTGGCGTGGATATGACGAACC