Description :
From Genome Similarity Track
Location :
Scaffold_63:23193- 26651
Transcript NameFunction/comments
Hyaar_Emoy2807361hypothetical protein
Hyaar_Emoy2807362AAL162Cp (ISS)

Sequence
3458 bases(100 bases per row)
TTGTCTCTATTTCTAGAAAGAAAAGAAGACCAAACAAGATGACGGTGTTCGCGAAGTGCCGAATTTGCACAAAGAGCAGTTGCTCAGTATCCTCGAGACT
ATTTGCACACAAATGGGTCAAGTTGTGGTACGTCCCATTTTTAGGATCTTTTTTTATTTTGTAATTTAGTCCGAAACAAAATCAAAATTGGTTTCGTGCT
AATTGCAATAAAAATAATTATAGATGCAATTAGCCAAACTCGAAGCCAAAATCCGTCAGGAGTCGTCGCAGAGCGGACGTTCGCTGCCTGAGGACCAGCT
GGCGTCGTACCTAATGGGTCAGTTCGAAGAGGCCATGAAAGCCATTGAGTCACAAGTGTACGCCAAGTTCCAGACCACAGAGGAGGAGGTGAAGATGGCC
ACCGAGTACTTTGAGGAGGACGATGACAAGGACGTGGCCAATGCCGTGGCCAAGCTCCAGGAGCTCTACCGCGTCATGACGGGCGGCGGCTTCAGTGATG
TGGAGGTCCCTGCTGAGCTCACGCTCACGAAGTTCATTGAGATCATGCAGGAGACGATGGAGTCGCTGAACGTGGCCATGGAGCTGGTCTGCCTCGAGGT
GAAGGAGCTCAATCCAGACAACAAGGAAGAGGCGATCAACCAGAGATATGTAAAGCGCGCCGACAATTTGTCGGCGGAGATCCATGCCAAGCACGGACTC
ACGCGCGAGGTGCTCCAGGCTGCTATGATGAAGTACCAGCAAGAACCGGCTTTCTTAATGGCCATGACGGAGCTTCAGCAGCAGCAGGCGGAGCGTTTTG
CGGCGGCCGCCGCCGTCTTCAATGGAGAGGTGAACATGGGTCTGACTGAATAAGCACGTACCAACAATATCTACTAGAAGAAAAGACCACGACACAGCTT
CGCCCAGTTCAACTGTCACCACGTCTCCAGCCACCCCTCTCTTTTCTACCTGCTTCCAAGATGTTCCCGACGCACGGGCACTCATTTTTGGGTGCCTTCA
CGTCGGAGTTGCGAAATTTCAAGTCGTCCTTGTCTCACTCCATTGCTCACCAGGAGCGAGGTAGCAGACGGGAGAGAAGGCTTGCGACCTTGTTGCCTTT
TGATTGCATGGCTGTGCTTGTGCGTCGGCTACGTATTGAATGAATGAGTTGTGTCGGTCAACGTCGCACTCCTGTTTTGTTTGCTTCGATGCTACATGCT
AATTTTTACTCGTTCGCCAAGACCTTATAGTTGTTGTCACGTCGCTTTTCACAAGCACCTTGTACTATTGGAACCTTCGACCTTCGACCTAACAAAAGAG
ACCGTCATTTTAGCCTTCAAAGCCAGATGCTCGAGTCGAGTGGTACCCCTACGATCTAATGGTAACAGAGTCGTGCAACATTTCGCGCAATCAATTTATT
GTTAAAGCCTAGCAAGTTGACGAACAGGTAGGACCCATAACATGATCGAGGACGATGTCCTTCTAGACTGAACGTGTATTCTTACGCTGTTGCCGATATT
TCGGCGAGGATGCACTAGGTCTAATATACACGCATTGTTGACGTTGTAGAAGATTTTAGACAACAAATAGCGGTCAAGATTACTTCCGTACCTTAAGAAC
CACAGACAAGTTCCGGATAATCCATCGCTACTACCATGTCTAACATCGACATGACTGGAGTCTTTGCGTCTTCAACCCATTTCATCTGGAGGATCGTTGG
CAGCCAAAACTATGTATTTAATTTAGTAGCAAGTACAACCAAGCTTGACCGATAGTCCTTTCTCATCTCCTGTGCACGCACGGTGATTCCTATCCACGCA
AACACACAAAGACCCGAGACACGATACTGTACCCCCTTTCGTATCACAAATGAGCGAGCGGCGGACCAAGCTGGCAATCTTCTCGTAGTTATACTCGATT
CATGTCTTCGGTCCGAGAAGGGGTAGCGACACCTCGCTGAGACGGCGTGATGGAGCCATCCGTGCCCGACGACCTCAACACTGCCATGAGCTGCGAGTGG
TTCAACGTGCTATTCCGCATGGCCAGCGCCACGCTGCCGCAAACCATTTGGCCGTTGCTTCCCTGCCCCTCTCCTTCTATATCGCCATCTTCTTCGTCTA
TATCTTCGAACAAGAAGATGCTGTCATTCCATGACAGATTAAAGTCGAACTCCGTCTCACGGATGGAGTTATTGGGCTGCTCGCCACCATGACTCAACCG
AACCATCTCCGCCGGAACGTCCGGCACAACTGTCTTATCTTGGAAAGCAAGAATCGCATCATCAATCTTCTTTGCCTTCGGAACGTGACCGCGTACAAGA
GCTACAAGCTCAAAGCCTGACACCGACTGTTGCACGTCAATAGGAATAGCTTCCACAAGCCCAATCGGCTTCGAGATTCCCTTAAAGCTGTAATATCCAT
GAAACTTAAACTGGAAAATCGTCGACCCTGGTACGTCCTTCAACACTTCATTCTTTGCAAGAAGCTGCTGGCTACGACAGATCGCTTGTGCGTCGCAAAA
CGCAGTCCAAGCATCACCACCAATAAGTACCTGGCCACCGTGGGCAGCTTTGGCAATTCGCGCCGTCTGATTCACAATGTTGCCGAAGTAATCCGCGCGA
CCACTAGTTTTGTGTGGACTTACGCTCGCTGGCACGCCAGTTTCGATTCCCATCGACATCGAAAACCGCAGCTCCTGATTCTCGTTCTCAAGATCCCACT
CACGAAACTTTTGCCGAATGCGTATCTGAAACTCACCGCACCACAAAATAGCGCTCGCAGGTGTGAAAAATGCCAGCATAAAGTCTCCCTGTAACTCCTG
ACACTCGTAGCCATTATGTTGTCGCAGTAACTCACGCGCAACCATACACAATATCTTGATGCGGTCCGCAAGCTCTTCTGCATGGCAACGGACCAGTGGT
CGAGCACCTTCGATAAACGTAAATACCATCGTCACTGGCTTGTGTGCCGATGGAGCATCTCGCATACCCAGTGACAGCTGATGCGGACTTTTCATGGTCG
GAAAGCGTCTCAACTCAAGATCCCGTGGTAGAAGCAGCATCAGTAGCACTTCGTCCCCTAAAACAGCGTGGCCGCCCAAGTCCTCCACCACAGGGTTGCC
CAGCTGGACAAGCTGTTCCTTCAAGCGATCCCACACGCTGTCACTCAGCACAATCTGACCTCCATGTGCGTATTCACTCACCGTCTTGGTCCACTTCACA
GCTTCACATAACGACAGCTCTGGAGTAATATCGGGGTCGGCCGTATGGATGACCATTCGAACACGAAAGCCGCGGTACAGCAGCATATTCTTCTTCGTTT
TCCCATTCGTCGTGACCGACACCTCCTTCATATCGTCAAATTGCTTCAGCAGCTTGTCGTTCCACGCGGCGTACACCAGACTAAGCTGGAGCGACAAGCA
CCACTTGGCGGCATGGAATTCCGAGGCAAACGCAATGACAAACAGCCCCGACCGCGAG