Description :
From Genome Similarity Track
Location :
Scaffold_26:231924- 235198
Sequence
3274 bases(100 bases per row)
CATCCCAGGTGCCCAAACCGATCGAAGAGACGCTAGTACGGTCGGCCGCAAATCAGGAAGTGGATTGTGGCGTTATTTGTGTGGGCAGCACTTTCGGTCG
TTAGCGACGTCGTAGGCGGTATATATCCAACGCGCACACATATCCTGATGAGTCGCAACGATGGACGCTATTCAAAAAAAATTGGTCTTTAACAGCTAGT
TAGCATCATGCCCTCGATCTTCGATAAGCTCGCCATCCCTCTGCATTTGATATTTCGAAAAATTATCCTGTCTTTATCCTGCATTTCCGTGCCACCGTGT
GTCACCTACCTTCATACTGAATTGCCACGTGATGATTAGAATCTCGAGAGGAGCCTGAGTGTCCGCGTAATTGTGTATGCATGTCCTAGGGCGGAAAGCA
ATGTCCTTGCTTGTGCCCTCATGTATTGCTTCTGGATGAAGGTGCGATAACATGCATTGCATACATGCTGCTGTTTGTCCTTATTTCGATGTTGTGCTGT
GATTTTGTACCCGATGCGTTGATGCTTTGACGAACCATTCTGTAACTCCATTTCCATACAAATGTCTGCACTTCGTCTGACATTGTCCGCGTTGCACAGC
AGTCTGTACGTTTGCGCTCCGTTTTTCCTCTTTGATATCAATAATTCGTCCGAGTAGTGTAGGTTGCGTTGCAAAGAGCTGCAAAGCATTCGAGCCGCCC
CAAGTAACTTGAGTGTACCTTTTGCTAGGATATATCGCATGCCCCATGGCACAGGCTACTTAATTGCAAATTGTTCTGTCTCTGCTGCTTTCCTCCCTGA
TTTCTGACATGTGTTGTCGTCCTTCTAGCAGCTAATTCCATCGTCCACCGTGCATAGCTAACGATTACAGCTCCCGGTGGAGGTTCTTCAGTTATCACAA
TAATGCATCCATCATATAATGTTCTGCTGTAGCAAATCTAGATCACACCCTTCGCACATCGACCGATTGAGTAGGTGCGGTCGGTATCCCGCGATACAAC
TGACATTGTGTTGCTGTGCTACACTTCCCTACAGGTGTGTGGGTTTTGGTCTAACGCATCATACAATGAATTGAGCCCACTCGATACAAAAGTATCTCGG
GCACTTGCGTATCGCTCGACTTACGCCAACTTGAAGCAGGACCACAACGGTATATGAGCTACATCGTTGTCTGCTAATTCGTACTCCCTATAACGTCGGA
CTCGTGTCACGATGAGCTGCTACGTACATCTATGGATGCTGGCACTGCGGCTGCGTGATCGATATCTGCTGGTCACATGCTACTGCTGTACGTCAAGACA
TTATACTCGTACACACGCACTTGACCTTCATCACACCGAACAAGACAATCGGGCACTAGAATTCGACTCTGCAGTCGATGTAAAGATATCGAAAGTCCGG
ACAGTCCAATCATAACTTAGGCATTGAACCGGCAGGCACTTTAACTCAAGTACCAGCATAAACGGGTCCTCAATCGCATGCTACAAGGCAATCAGTGGAC
ACGAGATAATATTCTCCTTGTCGGGTAACTTCGATGGGTCAGCGTCTTCATATAATAATTTGCTAGGAACTACAGTTTTTCCGCTAGTGGCCCATGTGTT
GTCGTCTGTTGCTGAAACTCGTCCTTAGCTTCACCGAGCAATCCAGCAAACAGTCATCCACACAAATTGTTTTTAATCGTCCCTAGTCACGGCATGTAAC
ATTGATTGTTGTGATTGCCAGACCCTTCCTCGACGAGGCTGAGCCTTGATAATAAGACCGTACTTGGACAGATTCAGCTCCGATCTTTCTTTTTTCGGCA
GACAGCGCAATGGAGTGGTGCCAACCTACTGAGTGGTTGGATAATACCGGCATCGGTAGTTGGCCACACTCGCAATCGATTCTTCATCGAAATGAGTAAG
TACGCTATGCGTTGACACGATATCAAGGATGTCAACCTGAATAGCTGCGCCACATCCAAGGCCAAGACTGAACAATGGCAGGCTGTCCGTTCTCTCCCCA
CAACAGGCGTGGCAAACTCAGCAAATCTTCAAGCTGGTCTCGTCGTAGCCTCAAGGCTCCGTTTGACACGCATTGATTTCGGACAAGACTTGTATACCAT
CCCTATGAACGTAGCTGACTGGTGTCTTGTAATAGGCACTTAAATTTTGTAATCATCATAAGGTGTGACACGGACCGATTCGTGGCATGGGGATGTCAAC
CCCATATACTACTTCTTCGTAGATACTTTGTGCTGTAGTACCAGACACTATCTTATCCTGAAAATCGATCATGCCCGGGTATGAAAAGTAAACGAATGGG
ACAAGCCGAACTGTTTGGAACCATCGTTTGAGTATTGCAGTATGTTCCGTCGTTTGTTGGCATGATCGAACTACATGTAAGAACGTTGTGCTTTTTCTCC
TAACGAAATCTATCATCCGAGAACTGTGTTCGGCTATTGTAAGACAGCGCTCGGAACGCGGCTTGTTTGAAAAAGAAGCACAGGGGCAGTCAGCCATGTT
TACCGACCGCAACCCCCGTGTTACATTTTGCTAAGAAGATACACACGTACGGACACGACCGTAGCAACATCCATTCCAAGCGTGTTCTGATGCTCCATCT
CCTTATTCAGCCGACTGCACCCTATCACACGTTGGTAGCACTTCCTCGTGTTACCCTCTGTCTTCACCAGGCTCTACTGTACAGCATTTCCAGAGCCTTC
AACAATTTCATAAAGGTCACGACACGCGTCTATCAGCGCACCTCAAACACTTTGCATTGAAGAATGCTCGAAGGCAGTTTACGTTGGTTTATGGCCCTGA
TCCAGCCGAGGCAAACGCGAGTAACGTCTCACCGCTGTTTGGTTTTCAAGTTTGTATTGACACGACCGAAATAGAGCACACACACCCTCTCTCTTATCAC
GCGATGTGGTAGTAGTCTGCTGTGTGATGCCAGCAGGATTTGCTTTCTACTACATATTGCTGCCTACAGCATGACGTCACGTGTTCTTTGACCGCTGCAG
AATAAACCGCTCAGCTAACAAGCCAAGAACAATTTTAACAATTAAATAGCAGCATCAAATAAATAAACAAAAGAAGAAAAAAAGGAGAAAAAGAGGAACC
AAGCTATTGGCTATTCGAGTGTCTCCGTCTCTCTCCCTCGTCCAGCATTCAACTTCCACCACTTTTTGCAACAATAGCAACCCATCCATTTATTCTCTTA
ATTCAATCCCTTGTCTCTGTCGTGAAAAATCCCCCTGCAAAACGCACCTCTCCCTGCGTCATCGCTTTTCACAG