Description :
From Genome Similarity Track
Location :
Scaffold_99:23190- 26080
Transcript NameFunction/comments
Hyaar_Emoy2809306nucleolar GTP-binding protein 2
Hyaar_Emoy2809307PREDICTED: extended synaptotagmin-1-like

Sequence
2890 bases(100 bases per row)
TCTTCTGTACCTTTTTCCTCCACCTTCTCCTCGCCCTCGTCGATCTCCTCCTCGTCCAGCACCACGGGTTCATCTTTGTCAGCTTCTGCTTCGTTTAGTG
GGGCATCGTCGCCCTTTTGCTCGAGAGCTGCAAGCTCTTCGGCACGCATGGGTGGGGCGATAAACCACGGCAGTTTGCCGCGCTGGTAGTCGTTGATCAT
GTGCACAGCGACGTTGTTGTAGTCGGGCTCGCCCTTCGGAAGCAGCTTGCCACATTTGTTTGCAAGTTTCTCGAGAAAGTCCCACTCGTCCTTCCACTCC
TCGATGCCGTACACCTTGATGAGAAACTCCTTCTTGACCCGCTCCAAGATAGTGAGGATAAAGTCCGTCGGCTGAGGTAGACGCTCTGCGCGAACGACAC
CCTTGAGCACTGTCTCAATCTCGTCGTCACCCGTGTCGTACACGATACCGGGACAGTCAATGAGAAAGATGCGACGCATGAGCGTAATATACTGCCACAC
CTTGGTCTCGCCTGGGATTGGGGCGACCTTGCACACCTTCTTCTTGCGCAGCGCATTAATCACCGAGCTTTTTCCGACATTAGGGTAGCCAATCAAGCCA
ACCGAGATCTGCTTCTTCTCCTGGTGCAGCTTAGCAAACTGACGCAGCAAGTTGATCAGTGCACCTTTGCCAAACGGATTACTCATCGAGGCGTGAAAAG
CCAGCGTCGGCGTCGTCTCACTGAGCTTTTGCACCCAGCGTTTGGTGACCCAGTTCGGCACGAGATCACACTTGTTGATGACAAAGATCAAGTGTTTGTG
CGACGCATTCTTGCGGATATGTTTCTCCACGTGTTCACAGCGCGTTCCTGGCACATTTCGTGCATCCAGCACCTGGATCACCACGTCCGAGCAGTCCAGT
ACTTTATACAGTTCACCCCAAATGCGTTTCGACTGGCCCTTGTTAAACACATCGTGAGAGACCTCGTCCTTAAACTCCTGCTCCACCACAATGTTGCGAT
CGTTCCCTTTTGTCTCGTACTTCTCTGCACTCTCCTGCGCTTTAGAGAGCAGCGACGCGTAATCCGTTGCCGCAACTTTGGCCCGTTTCCGGCCTCGCTT
CCCGTTAAACACGTCGTCGTAGCTCTCCGTCTCCAGGAGCTTCATGCGCGACGTCTTGTCGCTCTCTTGCAAGAGCCCCATCGGCAGTTTCCGCGTTCGC
AACACAACCGAGTAGGGATCGGCTGTCTTTAACGACATTTCGTTGCGAAATTTGTCCAGCTCCTTCTGCCCCACGACGCGCGTGTTGCCAAACCAGCGAC
GGTCCGGCTGCACGCGTCCACTGGCACTGGTGATCTCTTGTCCGCCCACTTTGTTCTTCATCATGAGCGTCCCGCCCACGATCTTGCCCCCCTTGTTACG
GATGGGACCACTATTGCGGTACATATTGAGCCGCTTGATCGTGCTCTTGTCCCGCATGTTGGCCGCTTTCTGCCGCGTTGGGACCTTACGGTTCGGGTTG
TCGCCCGACGCTTTCGTCGTGTTGATCCCCTTGGGCATGGCTACAGTCAAAAGGCGCTCCTGCTTCTACTGCTTCTGCTTCAGCTGTGGGCGCGTGCGAG
CTCGTCGCGGACGGACCTCTTGAGAGCGATTGGTTGGACGTGTCGAGTGCCGAGTTTCAGCCAATCAAGCATCCGCACCTCGTGTTTCCATCATGTCCAA
GTGGGGTTACATTTTGTCCCACCCATCCCGACCCATCATCATGTCTTTTTTTGCCACCTCTACAAATCCATACCTCCCCGCCACCAAATAAAGCACTTTG
TACAAGAAAAAAGACAAAACTACCACCATCACCATTATTCTTCTGATCCCGTCGTTAATAACCGTCATGAAAGCTCAGCCGATGCCGCCGCTCGAGCGCG
CTGAGATGGCGTCGTACTTATTCGAAAAGCACCTGCACCACCAGGACGGCGTGGCCGGGACGCTCAGTATCCGTCTCGTCGCTGCGCGTAACCTCCACGC
TGCCGCGTCCATGTTCTGGGTGCGCCCGTGCAGTCCCTACGTGATCTTCCGCGTGGGCAAACAGAGCGTCCGCAGCTCGACGATCCCGCGCAACTCGAAT
CCCTCGTGGCGTCGGGAGCTGCTGGAGGTAAAAGTGCCGAAACTGGACGTGAAGCGGCAGCTGCTGAAGGAGCACTCGGACGTGCGACTGGAGCTTATTG
TGGACGTGATGAACGAGGACTCACTTACAGGCAAAGCGACGGAAGCAGTGGGGATCGTCAATGGCTCTGTCATTGGCACTGCACTCGTGGACGTGACGCC
GCTGGTGGAAGGCAAGGAAGACGTGCTGGACCAGTGGATTCCGCTCAGTGGAGCTCTGTCTGTAGCAGGCAGTGGCTATAGCCCTAAGAGTGGCAAGAAA
CAGCACCCGGAAGCAGAGCTGAACTTGGGTGAAGTGCGCGTTGTGTTGCAGTATGAACCACATGGCATGGAGCCACTTGTAGGTGATGTCGTTAAGATGG
AAGGCTTTGGCTCGTACCCCTCGGCTGTGCTTGGGCCTGTGGAAGAGTTGGAGCTTCATGTGAAGAAAACAAGTGGCAGCTATTTACTGTGCAGCTACGC
CACTCCGTCCGGGTATGACGCGACGCTGCGTGTGCACCGCAACACGGTGTTTGTCGCGCATCGTGGTAGCATGTTTGACCGCTTCTATGAGATGTGTGTG
GTTGAGCCACTGGAGTTTGCAGCGAACACGCCCATCGGCCAGTCGGCCAAGGAAATGCTGCGGCCGTACATGAATGTCGCTCGTGCATTTAGTGGTCCGG
CATTGGTTGCTACGAAAGCAACGATCATGACGACGTATCGTGCGTCTACTGCTGCGATCGGTGCTGTGGTGGCATCTTTGGACGAATAAG