Description :
From Genome Similarity Track
Location :
Scaffold_252:23188- 24714
Transcript NameFunction/comments
Hyaar_Emoy2813198Amino Acid/Auxin Permease (AAAP) Family

Sequence
1526 bases(100 bases per row)
TTAGTTGCTGCTGCTGCTGTTGTTACGGATATAGTACGGTTCGTCCTGGAACTCCGTGTTACAGTACGGGAACAGAGTGGGGTCGTCCGTGGGCGTGAAC
AGGTGCTTGCCAGCATCAATCATCACATACGTACCTGCAAAGGCGCAGACGACAATGACCACCATGGAGGCCCCCTTATCCCAAACAGACATGGACTTCC
AGCATACTCGCCAGTAGATGATCAACGGCAACAGCAAACAGCTCGTCGTGTGGGCAGTGGCGCCCGTGAAGTCCTGGAGGTCGATAAAGCGCTTGCGTGC
CAGCACAGCAATGACTACCAGGATGCCAACGATCGTGAGCCGCAGAGCCACGTAGCGCAGCGGGTTCTTGCGGTACGGCGCGTTCACTTCTTCTGCTGTG
ATGCCACCGAACTCCAGCGCGACCCGCAGGTGCGACATCCGTCCTGACTCTTTTTCAGCGAGACTGGCGGCCGAGACTTGACGGGGGTGGGTCGTGTCCA
CTGGTGTCGAGCTCTGCATGTACGAGCGCTTCTCCTGCGCCTCGGGATCCATCTCGGCGATCATCTGGTCCGGCAACTCTCCGTTGAATCGAATCACGTC
GGGGCCCTTGTGCATGCCGAGAATCAGCCGCTCAGCCATGAAGAACGGCGGCATCATGAGCGTCGAGAAGGCGATGGAGATGTGGATCTGCATGAACAAG
TACGCCATCACCACGGCGCCACGGTCGGCACTGAAGCCAAGAGGAGCCAAACCAAGGGGGTCCGACGTGTTCACGATCGAGTAGAGGATGTTGCCGGACA
ATTGGCAGCCACCTGCAGTGTAGCCAGCCAGAGCCATGACAATGAAGAGCGCCGAGACGAACATGATCGTGATCACCACGACACGCGGCATACGCTGCGG
CTGCGAGTGTTCACGTTGGAGATCAGGGACGACGATCGCAGCTCCGTAGGCCAGTGCGAGGTTCCCGAAACATGTCAAGACCTGATGAGCCGAAATCGCA
GGAGAAGGGGCAGAGGTGTGGCCCCGCATGTTCCACTGCAACACAGACACGGCAATGATATCAGCGACGATCGTGCCGAGACAACCGGCAAAGGCCATAC
CAGAACTCTCCTTTAGTGTCGGAATCAGACACACGGGGGCGACCATAAGAGCCATGAAGATGATCCAGAAAATCTGACTGAACGAGTCTGGAAACAGCAC
TTCCAGCATCGTACTTCCAAGTATGAGGAATGCAATGGGGCACAGGAGACACACACCCATCTGCGAGGCTACCGTGAAGAAACGGCCCCACTTGCCCAGG
GCCCACTCGCCCAAGTCACCGTACGTCCGCACTGAGGAGGGTGCCACGAGCATCACTTTGGACAACTTGAGCGTGGCGTACGTGTTGGCAAAGATCATGA
AAAAGAGAGCCCCGGTGGCGAATACGGGACCGGCACGAGCGTAATTGGACGGCATGGCCAGCGATCCGATGCCGCAGACGCAACAGAAGAGATTAAAGGA
TGTTTTCGCATCTTCCAGCGTGAAGA