Description :
From Genome Similarity Track
Location :
Scaffold_127:23188- 24573
Transcript NameFunction/comments
Physo_143015single-stranded nucleic acid binding R3H domain protein

Sequence
1385 bases(100 bases per row)
AAAAAACACATTATATATTCAACATGAACCGAAGTTCAGTCTGGCAGCTTGAAGCTGTGCAATATGCAGCATGAATACATGTAGCAGTAGTGTGAGTTCA
TGTAGATCCACCACGGTAGATCGAGCAGCGTAAGCGACCCAGCAAATGGGCGCATGATACTTCACAGTACAAAAATAAGAGCATGTGCTAAAATTCAAGA
ACTTCTTCATGCAGCGCTCTTCTACGGCAAGCGTAGCGCTACTACATAGTACTATCAGTAGTAAATAAAGTTTTTCTACCGTGCAGGTTTTGGAATCCAG
TAAAAAAAAGCGACCGAACTGCGCCAAAGCCCGCAAACCAGTATGAATGGATCACTTCAATAACTAAATGATTTTGAGATCCACAGTTACTATTACCATT
CAAGAAGGCGTATGCTCACTAGGTGACAATGCGCAGTTGAATATTTAGTGCAACCTACTACACAGCAAACCATGTTTTTAGTCCCGGGCTTATGAAGCCG
TCTTCAAATAGTTTCTAATGCCTCGTCACCATTTAGATCAAGGTACGGCTGGACTTGAAAACTGTCAAGCCGGTCTGTCTATTAGCAAACCAAAGAGCTT
CGTTAAAAAGTAATAGGGTCTCCTCGGCTTTCGTTTTAGTCCGCTCCTGCTAAATCCTTCAGCTATGCTTCTGATGCAACTAGTTAAACGCTACTTTGAA
TCCCCGACGAATTGGTCCGCTGCTCCAACTCCAATACTGCTGTCCAGTAACATGCACACTTATCTACACGTCAAGCACCTGCACGCCCCTCGTGGTCGCG
TCCCACTGCCGAGTCTCGAACGCGTACCCGTTGCCCTCGAACACGCTGTCCACGGCCTTGGCCACGTCCCAAATGACCCGACACCGGCCGCGCACCACGT
GGTCCAGCTCCACGATCACGTCGAAGATGGGGTTGCCAGCTCGCTGCGTCTGCAGCTTGCTCTTGGACGCCGACTGCGCCGCCGCGCTGTCGCCCACGAT
CACCTGCTGCGAGCCGCCCACGAGGCCCTTGAGGTCCGGGTTCTTGAGCAGCGCGCGGAAGTCGCCGTGCGCGCTCGCGATGAGCCGCGGCCCGCGCTGC
CGCACCGTGGACGCTGCCAAGACCTCGGCGCGCCGCCCGATCTCGTCCACGATGAGCGTCTCCACCGTGTGGTTCTGCACGCACTCGACCATGACGCCGG
CCTGCGCCTCCAGCGACCGCACCATCATGCGCCGCGCCCAGCCCACGCACTCGTGCGGCACCAGGCCGTCGCCGCCGATCTCGTTCGACGTGTCGATGAT
GCACACGTTCTCCATGGTCTCGGACACGCACCTCGCCACGTCTCGGATCAACGTCGTCTTGCCGCTGCCCGAGTGGCCCAGCACC