Description :
From Genome Similarity Track
Location :
scaffold_30:231864- 284338
Transcript NameFunction/comments
g2298.t1hypothetical protein
g2299.t1 hypothetical protein PHYSODRAFT_533148
g2300.t1 hypothetical protein PHYSODRAFT_533258
g2301.t1hypothetical protein
g2302.t1hypothetical protein
g2303.t1 hypothetical protein PHYSODRAFT_353200
g2304.t1hypothetical protein
g2305.t1 hypothetical protein PHYSODRAFT_320063
g2306.t1 hypothetical protein PHYSODRAFT_356191
g2307.t1 hypothetical protein PHYSODRAFT_532626
g2308.t1 hypothetical protein PHYSODRAFT_566444
g2309.t1 conserved hypothetical protein
g2310.t1 conserved hypothetical protein

Sequence
52474 bases(100 bases per row)
ACTCTTACATCCTTATCAACACCTAACTTACATTTAGAATCGCATCAAGCTGTAGACTGCCACCTTGAGATGACTGAGGGACCCACAACAACAATGAACC
ACCTCCTGTGCCAGGAAGCCCCAAAAAACCCGGACGCCACCGATCCAGATACAACGTTTTACCTCCCAAAGCCGTAACATTCGAGACCCAGGTTGCAGTT
TCACCGGCTCGGACATCAACTTCATCGATTTTGTTGCCGCCAGATATGATGTTGACAGTCACGTCCTTCGTATCTTCACTCTTGAAGTTAATATTCACAC
TTCCATCGCCAACTTTCGTCCACGTGCCGTCGCTGTTGTTGAAAGCACCCTGAACCATTTTCAGTGCTAGCGCTTTTTCCGCACTACCATCGTCGACCTC
GCCAATGAGCTGAGTAGGACCACATATTGGCTGGAAGTACTCGGAAAACGATCCAGCGACAGACCAATCGTCCCAAATCGCGTACATTCCAAGAGCCTTG
TCAGCGATTTTGAAAGCATACTCGCCAGCATGGAGAAAACTCCCGTTGCTGCTCGTTCCCGAACTGATGAGATCGTCCACAACACTCGCAAACGTTTTGC
GAAGAGTGTCACGTGTGGCGTACGCCGTCTTCTCGTCCGATTCCTCGATCAGCTCCCCCATGCAGTTATTAGTTGCGATAGGAATGTCGTTGAGCACCAA
GTTCGACTTGCTCATAGCTACACGAATATCATCTTCGGACATTTCCGGATTCTGTTTTCGATATTCAGCCACAGTCATCCATGTGCGATCCAGCAAGCGC
TTCATGTCGTAGCCACACGTGGAGTTGGATTCCATCGCTGATTCCAAAGAAGTAATGTCACTTTTGCTCAGCGAGCTGAGGGTCTCGCCTAGCGTGATAT
TCTTCATGAACGATGTGAACTTGCCCCAACTGGAGATGATGGTGGCGCCGTTAGCTATCACTTCTTTCAGAACGTACTCAGCAGTCATCATCACACTGTC
GACGAACTTGACGTCATCCGACACGGAGTTTCCAATGCAATAGGCGACCGCGATTGGGATATCAATAACGACATTGTCCGTTTGGTACAACATCGTCAAT
ATCTTGTCTTGCGAGGTTTGAGGGTCTGAGACTTGGAGAGCACGAACATATTTCGCCAAAGACTTTATCAAACCCATCGTGTACTTGGCGCACTTAATTG
CGACTTGCACAGCCCTTGCCAACACCGCGAACTTGCCGAACACATCGTACGAAATGAGAGATAGCGTTGTCTGAGCTAAGGCCGTAACCTTGGTGACGAT
TTCGAGCGCGCAGTCGTCGTTCTGTCGGATGCATTCCATGCCGCATTCCACAGGGTACGCGTATGGACACTGAGCCCAACAAGTTCCTAGCTTGCCTTCG
AATCCAAGCGGGCAAGTCTTCGCAATGTGGGCTTCTCGGTAGCACGCGTTGGCGATTGAAGTATCGAGAGCAGAACCGACCCAATTCGTGTAGGTAGACT
TGATCGTGCTGGTTGCTTTGATCACGCCGCCCATGGTGAGTGCAGCGTTCATGGTCCTGGAGATCAGTTCTGACTCTGCAGCTGCGTCGCTGACCCTGTC
CGTAGCCTCGTCCTGTGTGGAATCCCTGTCACTGCGGTCAGACTTACTCGAAAGCGCAGTGTGTGCGATGCTATCTATCGAGTCGCTGTCCTCACTGTCG
GTCGAATCGCTGTCTTCACTGTCCAATGAATCAAAAGAGTCATCGTCGCTCCTTGATAGCCCAAACGAAGACACAGTCGCTTCCGGCGTCCCAATCGTTG
CTAAGGTGTCCGACGCGGCCACAGTAACGAGAGGTGTCGGCGTTGGTGCTGAGTCAACAACTTTACTGAACGCGAATGCCTTTGCCGGAACCTGTGTGGA
CTCGCCCCTGATTGCTGCGACGGCGACGAACATCACCATTGCCCTGAGTATCATGTTTGGGCACTCACGCGCGCCAAAGAGATCGCCGGGCGGCGTTTGT
CTCGAACACAGCAAAATGGGAAGTGAGCTGTTCGATTAGCGAGCCCGCTCTTCGAGCCGTGTCTCTTTTACGGGCACCGGCCGCGAGAATCGTGTTCATC
TCTGATGAAAGTCCTTCGCTGTGGGGGAATCACTATGGCTGTACGATTCCTACCGCAGGAAACCCTAGCTTTAAAAAAGTCAAATCTTCAAAATAGTCGC
AGGGCAGATCATCGGAAACCGGTTTGACACGGCGTTCAGTATATTGAACACGGCTTTCCCGCGCAGCCATCTGGCCGACTCAAAATATCGCCGAGTCGTA
CGAGAGGGCTTGTCTCCGCCATTCGCTTGGTCGGATCGAATCTCCACTCTGCGAGAGAAACAGCATCTTGTGGCGTCGGGATAGGGACAAGGATAGGATG
GAAATTCAGCCTGTTCTCAACAATCGAGAGGCACCGCCCCGTGTTGCACAGTAAATTTTACGGACTGCATTCTGCAGCTCGAGACAACGCATGAACAGTG
GTGATGTGAGTTGCTCAAGATTTTTGATAGGTGTGCGTCAAAGTCATTTGACTAATCAGCCTGAGTCAGCCAAAGTGTGGAATGGGTCTTTACGGAGCAT
CATTTGTGCTGGAATCACTCCGCTGGCGGCTCTCTGAGTCAGCTCAGGCAAATTTAATTTGTATCTTTGGCTGGTGACTCCGTCTTAGTAAAAATTGAGG
CTCTACAGCCCTATAAACAAAACTTAGCTTACATTGAGTATCACGTTGAGCCGCAACATGCCGCCTTGGGTAGACCGAGGGACCCAAAGCAATAATGAGC
CGCCTCCTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCGCAGTCACGTTCGACGTCCACGTCACGGT
CTCCCCAGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGTATCGACGCTCTTGAACGTGATGGTTACA
GTGCCGTCTCCAACCCTCGTCCACATTCCGTCACTGCTGTTAAAAGCGCCTTGAACGATCTTCATGCCGAGGGCTTTCATCGCGGTACCGTCGTCAATTT
CACCGATGAGCTCTGTAGGACCGCAAATCGGCTGGAAATACTCGGAAACAACTGTGGATACGTACCACGGATCCCAAATTGCGTAGAATCCCATGGCTCT
ATCTGCAACTTTGAAAGCGTACTTCTCGGCAGTCAGAAATGTGCCATTGTTGCTCGTTCCCGAGCTGATGAGATCGTCCACAACACTCGCAAATGTTTTG
CGAAGCGTGTCACGTGTTGCGTAGGCGGTTGCCTCGTCGGATTCTGCGATCAGCTCGCCCATGCAGTTGTTTGTCGCAATGGGGATATCGTTCAGCACAA
GGTTCGACTGGCTCATGATCGCTCGAATGTCGTCTTCGGAGATATCCGGGTTTCGTCTGCGCAGCTCTGCCACGGTCATCCATGTGCGATCCAGCAAGCG
CGTCATGTCGTATCCGCAAGTTGAATTCGACTCCAGCGCCGTTTTCATATTCGTAATGTCGGTCTGCTCGAGAGAAGCAATCGAATCTCCAAAGGTAATA
TTCTTCATGAAGGCCGCGAATTTGTCCCAACTTGAAACGATGGCCGCTCCATTGTATAGGACTTCCCTCAAAGCGTACTCTGCAGTCATCAATACACTAT
CTGCAAACTTGACATTATCGGATGCCTTTTTCCCGATGCAATAGGAAATTGCCACAGGGATGTCGATAATGACATTGTCAATCTGATAAAGAATCGCGAG
GATCTTGTCTTGCGAGGCTTGCGGGTCATGAACTTTGATATAGCGAATGTACTTGACTAGCGACTTCGTGAGGCTGATCATGTACTTGGTGCACTTGATA
GCGAGTTGAATCTTCTTTGGCCACTTGGTCATGTCGCCGTACATTCCCCATGAAGCCAGCGACAGCGCCGTTTGAACTACGACTGCAATCTTACCGAAAA
TTGCGAGCCCACAGTCGTCGTTCTGCCGGATGCATTCCATACCGCACTCGATAGGGTACGAGTACGGGCACTGCGCCCAGCACGTCCCCAGTTTGCTCTC
GAAACCGAGCGGACACGTCTTGGCGATGCGAGCTTTGCGCCAACAAGCAGAAGAAGACAACGTGTCGAATGCAGAGCCAACCCAGTTGACATAAGTAGGT
TCAATCGTGCTAGTGGCATTCAGCACACTACCAAGCTTGAACGCCGCCATCCATGCTGCGGTTGGCGCTGCGGCGGACTCCATCTGTGAAGATGCAGTGT
CGTCGCTTTCCGCATCGTCACTGTCTTCAAAACTGTCGGCATCTCGATCGTAGGCTCTAGCTTCCAGCTTGACGGACAGCGCTGTCTGGCGAGAACTGTC
CGTGAAGTCTTCGACGCTGTCTTTTAAGTCATCTTCAGTCAGGTTGAATGAATTCACAGCCGTGGCTTTCCCCGTCGCCGACTCATGATCTCCAGCGACC
ACCGTAGCTAGGGACATCGGCATCGATGGATCGCGCTCGTCAAACGTGTATGCCTCGAGCAAGCGAATCCCGTTGAGCATCACTGAGAAGGCGGCGAGAA
ACAACGCAATCCTGGCCATGGCGTCTAAGCAAGAAACGTTCTTGAGCGAGTATGGCAAAATGAAGACTGAGATGGCAGTGAGGAACGCTTCACTGACGCA
TCGGAGTTACGAGTCCCAGGTTCTTGAGGCTCTCCTACTTGGCGGTCGTTCACGGATACCTTTGTCTGCCGCCGGATTAACGACCGCAATGTTCAAAGCC
AAGGCGATCTGGCCATCGAGAGGCGCTGCTTCCAATCCAGAGTATTATTATTCGTCGGTAGGATTACCAAATGTCGTGCTTTTGAAGGGTGCGTGTGTCC
TGCGCCAGTCACTTGTCGGTCACCGTTTGAGACGTACAACCACCAGGATACGAACAGGGATTAGCACGCCCGTGTTGCTCAAACATGTCGATTAAATTCA
ACTGAGACCACCGCAAAACGGCAAGATACAGTTGAAGCTAGGGATGTGACGCGAAGGTACGCACTCTGGAATGTGACACGAAGGTGCATTTGTTTGAATG
TGACACGAAGGTGCCGAGCCACAAGCCACACAATATCCGCTACATAGAGGAAGCTCGCGATCGACATGGTGCTCCACGTGCTCGGCGCTCTCCGTGCGGC
GGGGCGACGCGCCGCTACCGCCAGGTTCTTGGCCACTCGCAGCATATTGCAGAGCGCCACATTCGGCACGCAGGCCAGTGGTGCGTGACAGTTAACAACG
CGAGATTTTTTGGCACTTGCCTTTTCGCTGACATCACTATTTGTTTCTTATTTGCTGCCAACTATATATTTAGTGTACACGTGGGGAAATGGCACGCTGG
GCCAATTAGGTCATGGTGAGGTGGTCAAGTCGGGCATCCGCAGTGCGTACGAGGAGCTGACGCCCAAGCTGCTGGAAGCGTTCGAGGGCAAGGCCATTAC
TCACGTGGAGTTCGGAGCTAGCCATAGTGCTGCCAGTATGTCAATTTGTGGTTTTCTTATTTGTTTGTTTGTTTTGGTGGTGCTGATCTAGTATTTGTGC
CTTTGTGTGCTTGTACTAGTTGACGAGGATGGCAAGCTGTTCGTGTGGGGATCTAACGAGTACAGTAAGCTAGGACTGGGAGAAACCAGCGAGATGGAGA
CGCTCCCGCGTGAGGTGGAGGCTCTCAAGGGCATCAAAATCGTGGACGTCTCGTGCGGCGATTATTTTACGGCTGCAGTGGACGCGGACGGCAAAATGTA
CTCGTGGGGCTGGGGAGGCTCCACCATGAAGGGTGCAGGTGGTCTCGGCCACGCTGGCGGCAAGGACGAGCCCACGCCGCGTCTGCTGACGACACTGGTG
GACCAAGGAGTGCCCATTTCCACGGTGGAGTGCGGTGAATTCCACACGGTGGCGCTCACCAAGGATGGCGAGATCTGGGCCTGGGGTAACGGCGAGTACG
GACGTCTGGGCAACGGCGAGTCCGACACGTGCGAGGTACCAGAGCCTGTTGAGTTCTTCTCTAAGGACAACGTGCTTTCTATCGCTGCTGGTCGTGACTT
CTCCTTCGCGCTGACAGAGAAGGGCGAGCTGTACAGCTGGGGAGGCAACAGTCGTAAGTTGAAGCTATGGGGTTGGCGATCTTTGTGAGTGATGCTCAAT
TGCGTGTTGTGATGCTACCACAGAGAACCAGCTGGGTATTGGCGGTGGTCTGGCCATGGATGTGTACAACATTGAGTCGATTCCGGTGCTGGTTGAGGCG
TTCAACGGTCTGTCTGTAAAGCAGATCGCTGCCGGCTACGACCACGCTGCCGCTGTGACGGAGGACGGACGTTTGTACATGTGGGGCGCTAAGATCTGGA
TCGAGCCGCACGAGATGACGGCCGTGAACGAGCACAAGATGGTGCAGGTGGCCTGCGGGCGGCAATACACCGTGGCACTCACGGATGACGGCAAGGTCTT
TACGTTTGGCAAGGGTAGCTCCAACTGCCTGGGCCACGGTGACCGCAAGAACCAGCTGCAGCCTCTGCAGATCGAGGCTCTGGCTGACGTTAACATCACC
TCGTACGTAGCGGACCGTTTGCGGCGGTAAAGCGAATTGCAGAGCAGAAACTAACTGACCTCTATGCTGTGCAATGCAGGGTATCGTGCGGCGACTACCA
CATGGGCGCCATCGCGACACCCCATGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAAGTTGGCCAGTCGTAAGGGACAATAAATCGCGCG
CGGTCAACCTGATGCTGTTTGCTTCACCTTGCTGTTTACCGAGGCTGGTTTGCTCGTTCGTGTAATCCAGGACTCCGCAAAGCGTCGCCGATCTTTCGAG
TCCATTTTGCAGTCCTACCGTTGTTGATGATTCGCGTGGTGTTAATGTGCGCGGCAATTCTGCCTTGGCTTCTGCTGTTCTCCGGGCTGTCCCTGCCACC
GAACGATGAGTCAAACTCAACTTGGCGGCAAAACGGCGGCGTGGCTGTGTCGTTGCTGAATGGAGTATACGCATTCGAGTGGCGACAGGTTCCGCGGTGG
TGGAAAGGAAAGCGTCAGCTCACTCTCACACTGGACACGTGGCCCGAGCCGGAGATCGACATGGACGAGTGTGTGGCTCGCTACCAAGACTCCAAGCGCG
ACGAGGTCTGTGTCATCAGCCGGTAGACAACTATGCGAAGGGGAAGGAGGGGTCAACCGACGTATCAAATTAGTAAATCTATCGTTCTATACTGCCTTGC
AGTCTTCACTTGCCGTCACGCTTCCGCTTGAGGTTGTTACGGCTCTGCATGACAGCGGAACCGGTGCCGTCTGCCGCCACAACATCCGTGACAACGTACG
GAGCTTGGGCCGGTTCGTGAGCGGATAACATGATGCTGGCGAGTGGCATGCTGCTACGGACCAGGAGGTTGACACGCTTTAGTACTGACAGCGGCAACGG
ACTCAGGACAAACAATCGACGCTTCTCGGCGTCCACGGCGCGGATGACCCCCACGCCCACACACGGTGCGTGCACTGGCTGCAGCACGATACGCGGGGGT
CCTTCTGTGTCTTGCTCGAACGGTTTGTAGTCAGGGTTGATGCAGAGACCCACGATGCAGGCGTTCAACGAGAACAGGAGCTGGCTCGGAGGCACAGAGG
AGCTGGCGAAGGAGATGTCGACCTGGTCGAATGGCACCGCGAAGGGTGGGAGTTGAGAATACGCGCGGTAGATGTTGCTGTCCACGCGGTTCTTCTCCGA
GAGCACTTGCAGGTTCTGCAGCAGTGCGCGCGGGAGGTCGCAAGGAGTGCGGGCGAGGAAGTACGAGTGGAAGCGATACAGACGCATTTCCTTGGAGCTT
CGTGGGGGTTGAGTGACGCCAACGGGATCCCAGGGAGGAACTCCGTGAACGCGCCACCGACCGTCCGTGGGGACATCAAACTGTTTGTTTTTCGTCGCGG
CAACCAACTGCACGACGTGATCGGGGTTCGTCTCCTGAATGACGTTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCATCCGTCCGTATTAATTACCAG
CGGAACGCGAGCGCTTTTCGGGGGACTCGAGTCGGCTCCGCTTCCCCACTTGGCTTCATACAGACGCAGCAAGCTCTTGACCGCCTTCATGTAGTACAGC
GGGTCGTTGCCCGGGTTGGCGTTTCCGCAGAAGAACGACCGGACCGGATTCTTCATGTGCGAGAATCCTGGACCAAGCAGCGGCGTCGTCAAGGCGTGCA
GCGCTACAAGGCCCGACGGCGTGAGCTCACTCTGCCCCAGATCCGTGTCCAGGAAAGCGACCGTGTCAAACTTGGCAAGCAGTCGGTTCACCAGATACCT
GCAAAACGTGGACTTGCCCACCCCCTTGCCGCCACAGACCACAATCTTCTGATACGCTGGAGTCGCTTCGTCCAGCAGACTCGACTGCAACCTGTCCGCA
GTATCCTGCCACGCCTCTGTGAAATGCAGCGTCCTGAACGAGTCCACCACGACCAGCTCAGCCAGAACACGCTCCGGCGACTTCCAGTCATGATGCAGCG
GGTCCGTGTTAGGAGGCGCCGCACTCGTACAGTCGAAGCCTGCAGTGATGTCGTTCAGTTCGTTCTGGTTGTGTTTGGCGACCATCATCTTGAAACCAGG
CAGCACCGCCGCCGGTTTCTCGGGTCTCGCGTTCTCATAGAAACTCGAGATATTGCCGAATGTGACGGGGATGGCTCGCAGCACCAGCACAATGGGGAAA
TCGTCCGCGAGCTGCATGGCCAGTCGGTCCGCCGCAATCTCCTCGTCCTCGCTCAGCGCTTCGGGTGGCAGGTTTGGCTCCATGGCCTGCAGTAAACTCA
CATTGACAGGTCCGAACGGCGCCTGCGTCTCCTCATTGCCCGAACGCCCCTCGATCACCAGCAGGTTGTTCCACTTGGGTGAATGCAGCGAAAAGTAGAC
GCCCAATGGCGGCCGGAAGCCCAGCACGTCCACGTTCCCCTGGAAGAGCCGGAAAAGCGTCATACCGGCGCAATTTACGCTCGAAAACCTCTGCATCCCC
AGGGCAACCACATTGCCCGAACGCACACAGAGCGCGCGGTACAGCGGTGAAGATGCCGACGCGCCGGCCCCAGGACCGTAATGCGAGATGCTCGTCATTG
CGACTGATGATTGGCCACGAGCGATATGTGCGATTCTCACACGTCACATGTCCTTAAACGGAGGGTTTAGCTGCGTGCTGCTTCAACATGACAGACCAAA
AAGTCTGTCCTCCATTCTGTGAGCTCCAGTCTTGGAGAGTACCGCCAAGAAATAGGCCGGCGCTGACGAAATGCATCGCTGAGGTTTTGGACAAGAACAC
TTTCCGCCTATTCTCGGCACTGCGTCTCCATCCGTGCAGCCTCGTCCTGAAACCAGTCCGCAGGACGTGGAGTTATTTTGGAGCGGTTGGTCTGATGCTA
ACAGCCAGCTTTTGACTTCCAGCGTTCACTGGTCTCGTGCCGCGCTACAACCACAAAGCGCCGTCGAGAACTGCGAGCAACGAGCACGGCATGTTGCCGG
CGCTCACGACAAAGCCCAAACAGGCGGTGCGCCAAGTCAAAGGCCTGTCCAATGACTCGATCGATTCGTACTCGAACATGCCGCTCGGTGGGGGCGCGGG
CATTGGCGCAACATACGTGGATAATACTGAATCGGGCAGTGGAACGGCCCGCGGGTCTCCGCCAGCGTCGAATAGGTCGACAATCAACTCTGGGCGTGCT
TCTGTCGCTAAACCTTCAGCTAACGAGGAAGGTGCGACCTTGGCTCGTGTAGTGCGAGACCGAAAGGCTTCGGGTGAAGAGGAGCTGTCACTACGCACGG
GAGATATCGTCAAAGTGCTGTCCTCGAAACGCACCGGGTACCTCAAGTGCGAAGCAGGAGACGAAGTGGGCTACGTACCGTCGTCCTATCTGGAATTCCT
GGACGAAGCGGAGAATGCGAACGGCACTGCAGCATCAGAGGAGACTCAGACGCGTGCCGCTGAAAAGCAGCGCAAGAAACAACAACGAAAGGAAAAACGA
AAGAAAGAGAAGCGCGAGGTTAACGGTGCTAGTGACCCGGAAGAAGGAGCGCCAGTGTCTGCACGGTCTCCTCGTAAGGAAGTCCCTGCAGCAGAAGACG
AAGGCAATGAATCGCCACGAAAGAGTAAGAAGAAGAATCGGAAGCATCGTCCGGATCGAGAGGACGACGACGCAGGACGAGCGGGAGCTTCCGGCGTCGA
TGAAGCTCCGACCAGTGCCAGATCTCGAGCAGCACCCGAAGACACTGAACGGTCTCGTAGTAAAAGCAAACACCCCAAGAAAAAGCGCCACCGCGATGCA
GATAGCAGCGTGTCGAGTGGAAGTGACGCAGGAAAACGAGCTGCACGTCACGGACGCCGTCGTCGCCATCGACGCGGTTCAAGTGAAAGTGATTCGGGCT
CGACGTCTTCTGATGATTCGGATGGGAGCTACCGGCGAAGACGACGCCGTCGCCGCCACAGACACCGACGTTCTAGTGAGGAGGAAGAAGAAGACGATAG
CGACTACAAACGGCGTTCAAGACGGAGCAAGAAGCGTCGTGATAAAGGCGGCGGTGAATCTGAGCCTGAAGAAGGGTCTCGGTCAGCTCGGAAGGCCGAG
AAGAAGCTAGCTGCAGCCTTACAGGAAGCAGAGAAAGGAGTGAGTCAGTTAGACGTGAGGTCCGATGAAAAGGCATCGGAGCCTGTGGAGGCGAAAACGA
CTGCCTCATCGAACAAGAAGGAGGAACCGGACCGAGAGCGAGGGAAGAAGGAGGAGACGGAGCGGAGTGAAGGTTCGTCGGAAGGGCGGGCGACGAATGT
TTCAACGGGACGTAAGGACGATGAAGGGCGTGCCAGTAGCAGCGCTTCGTCTTCAAGCCAAAAGCAGAACGGTAACAGTAAGACTGGTCTCGGCAGGCAA
ATTGGCGACAAGATGCGCTCATTCCTGGGTGGTAGCAAGAAGCAGCACAGCAGCAAGAGTTCAAGCGGCATTTTGAACGCATGTACAGGCACAGTTCAAG
GCGAGGAAGGCTGGTACGAGCACGGCGAGAACGAACGCTACTATTTCGTGCTTGTAGATGGAAAATGGAGTCTTCTGTACGGACCCATGACTGAGGACGA
CTTCGAGGTATTTTCCAACCGGGTACGTTGCTTCGTTCTCCTTGAAAGCGGTCCTCCACTTTGTTCTGACCTTTTTGCTGTGTTGTGTTGCTCGCTTGCA
GGTGCTGGAGCAAAGCCGCTCCATCGAGCTGCCACCGACGTATCTGCACAAGTCAGGATACTATCTCAACCGCGAGCTGCGTGTGCAGAAGGAGAAGTGA
ACAGCATAAAGTACTATCAGCGCTTCCTCCTCCTATCACCTTCTATCGAATATATCATGCGAACGAAAGTTGCCAGTAAGCAATATGCATTATCCATTCA
TTAGAAAGTGTTGGCTAGCCTAGCAAACAAGCAATAGATGCAGGGAAGCGCTTGGTATTCGAGTCCGTCGTTCTCTTACTTGGCTGCACCCGTGAGCGAT
GCGCTGGGAGTCTCCAGGACGACTTCCTTCGGGAAGTAGAGCTCTGGTTTGATGGATTCCTCCTGGGGACCTGCACCCGTAAGCCACTGTGAGGGAGACC
GCAGCAACTCCTTCAGCTCCTCACTTAGCGATAGCTTGCGTCGTGGAGAAACAAGTTGAGTCGCCCTCTTGGGTTCGATCGACACTTTGAATTTCTCCGC
CTTGTCACCGCTTGACGCTGAAAACGCCGCATTCGCAGCAACCGCATTCCTCACGACCTTCCAGTTTGTGTGCTTCTCATGGGGCGATAATGGCTGCGCC
ACTCGCTTGGAATGGGACAACTCCTTCCACGTTGTATCATCCACGGACTGATTGGCGATGTCATCACCCGTATTCAGATCCAAACGCAGACTGGATGCCT
CCTTACGCTGTCCAAGCCGAACTTCGTTCAGCTTGCGGTCCACAAAGGTTGCCTGCAACTCAGGAGCTACCCTCTGTGCAGAAGCTGCCACCATGTCTTC
ACTCAACTCCTCGGAGCCTGCCTTGCCTTCCGTATGGTAATTCATTTTTCCTAGCAGCTCTGGCGTGCGGGTAATGCTGAAAGTGCCCTCTCTGTGCATC
TTCACAAGTTCCGTAAGATGCTGTTGCTGTGGTAGCCAATGCGTTGCCACCTTGTGGTAAGCTTCGCGGTGACGCTCGTTCAGGCCATTGGGTACCACGC
ACACTTGTTCAAGCTTGTGCAGCAGTACGGGCGTCTCTTCCGAGTGGAGTTTTCGGTTGTTCATGCAACGCTCTGCATGGGTAACCAGCTTCTCGAGTAA
CTCGAGGTTGGACTGGTATCGTTCCTCAAGTTTGGCTTGTGCCTCCTGCTCGCGCTCTCGCAGTCTCGAGCACTTGTCACGCACCTCCCTTAGCAGCTTT
TCCGTCTTCACCATGTCCATTTTATTAGCTGCTTCAAACAAGAGCAGACGATCAAGCAGGATTTTCACGCCGACACCTTCTCCAAAAGCAGGATCGCACC
ATCCTAGTCCACGCTGTAGCCAGCGGTTCCGCAACGTGAAGGCTGCAGATGCCCATTCCAGTCTTTGCCGATGCGCAGCGCTTAGCTTCCGCTTGATGCT
CAACGTCGATGTGTCGAATCCGAGCAGCCAGTCAGCAATGGACTGGCTGAACGTCCAGCGGCTCCACTGCTTTGGGATCGCAACGCCGTCCACGCTGCTG
CATTCGTCAAACGGGAAAGTGTCCTGCAATCGATTCTTTCCTAAATCAACACGCGAGCGGAAACTGGTTACCTCCTGGAACACGTTCGCAGCGTAACTGA
TGGCAGCGTAGTGCGCCATGGCATGCGCATTATCGCCCTGTGGGCATCGAGCGAGCATTTCATCACTTGGGGTACGAATTCGACCAGCGCCAACTGCTTG
TTTCAGCTCCTCTTTCGTGAACGCCTCAGCAGGTAGCCGATAGTTCGCACCAATTACTCGCTTGTTGATGTTGTGCAGCTCCATAGCTATTTCTTCCTTG
GTCACGGTCTCATCTCGAGACTTACCGAGGAGAGCTCGCACACAGCGATCCAGTGCTGCGTACGCAGCGAGCCTTTTAGTGTACGCTTCGTGCACTAGTA
GCCGCTGAAACCGTTCCACGAGCGTCATATAGTCGCCGCTCACATCGACCTCGGCATTTTCAACTGCAGCAGCGAACATGTCGGCTTCAGTCCTCTCATC
TTCATCATCAAGCACATGTGACTCGCCGGCAAACGTGCGCACCAGCGAATTTCGCTTGCGCAATGCTTCAAAAAGCAATGTTTTACGAAGTATCTCGATT
TGTGTGTCGATAATACCCAGCCCGGTATTTAACGCCTTCGAAGAAGATGCTCCACTTGTGTTATCAGAGGCGGCACCTGTGGATTGCGTGCCAATACGAA
TCCCACGTAGTATCACAGGATCGCCTTTGCGGTCCATGCCTCGTTCCTGGAGTAGTGTCTGAATTGCGGTCGTGTCCGGCGGCAGGAGAACTTCTTTTAC
TTGATGCCGGTGCATAAGTTGCAGTAACGTCGTGGGGTTCGCTGTCGTCGGAACGGCTATGCCTTTTGCCACTAATACCTCCTTCTGCAACGTGAAGGCT
AGTGATTTCACTAGATTCTCAACTTCTGTCGTTGGGATTTGCCGGAGTGTCATCTCCTTCAGCAACAATTGGTAATTCTCAGGCACGGCTAGCTCGCGAT
TCCTGCTCACAGCATGATCAACTTTCCAGAGCAAATCACTTTTACCGAGACTCTTCATCGATTGGTAGAGCTCGGCTACGCGTTCCGGATTGGGTAGCGC
GAATACTTGTTGGCTGTCATCGCGGTGCTTTTCAAGCATTTTCTCAAGCTCCTCAATCTCTTTCAACACAGTTTTCGGCAGGGCAACCGATTGCGATCCG
GATTTCGGATCTGCTAGAGACGGAGAAACCCACGCATCATCTGAATCGTTGCCTTTTGCATTCCTGTCAGCAGTCGGGTCAAAATTGGACGTTTTAGGAA
TCACACCGCGGTCTTCCAGAGCGAGACGAACATTCGCTGGAGTGAACACCATCTCTTGCTGTGTAATCAGTAGACGGATGTCTTTCCCGTCACGAGAGTA
AGACAGCCAGTTTCTCTTTTCTGTATCCACGGTAATGCGGTGATAGGGAATGCGCTCCAGTTCGTATTTTGCCTCCTCAATAGCGTACCATTCTGCCATA
CCCTCAAGCTGTCCGTTGTCTTCGGCACCACTGTCAGACCTGATACTTCCATCGGATGATACCCGACTACTGGAATTTTGATGGGATAAGCTGCGTGGTC
TGCCGCCAGCTTCATCCTTATTTTTCGGTGAAGGTGGTGCTGCTCTGATCGGATTGAACAGTTTCTCAGGCTTGTTTAATTCGCCTTGCCGGTTGGCACG
CATAGATCTCCACAAGTGCATCTTTTCAAGGATAAATGGTGTGTGCTCACAGTCGATTGAGTGCTGCTGCTGCATCTCTACAATCTCATGCAGCCACTCC
TGAACTTGCTCCCATCGGTTCTGCACAGTGTTAAGTGCCCTAGCATCCACGTCCGCAAAGCCCTCGCATTGCTCATCTAGAAGCAGCAACAGCTCGTGTG
TGCGTCTCCAATGCAATCCTTTCTTTTCCATTAGCCGCAGTTCGCTGAGAGGACCATTCGGCTGCGTAATAGCCATCCAACGGGACTGGATATTCGAGAC
TGCATCGGCGTGGCGCGTACTGAGTCCTTTGCTGCAACGCTGCTCCACAATTTTTAACAGCTGCGGTGCGCGAGTCAGGTTGAGCTTGCGTTCCTGCATG
CTCACGAGTTCCTCCAAAGCATTCAGCAATATTTGCCACTTTTGTTTCACCTGCTGCCATGCTGTGCTGAGTCCAACATCGAGGCCCTCGATCTCCCGTT
CAATATCGTCCAGAAGTTCAGGTGTACGTTGCGCGTGAATCAGTGCGGCGGCTTGAATAGTCATGAGTTCCTCCAGTCTAGGTTGCATGTTAACCCAGCG
TTTGTGTACTTTCATCACCGAATCTCGATAGGCATTTGCCACTTGTGCAACACTCTGCGTATATTCTAGCTCTTCAGCGTCAATAGCCTTCTTTTTGACG
TGGGTTGGCGAGCTCTCCTGCAATGCGAAAATATCCCAAACAAGGCTGAGCAATACCGGGGTGCGTTCCCAGTGTAGTTTACCCTGAGCCTGCTTCGTGA
GCTCGTCCAGGTAGCCTTTAATCGTCAGCCAGCGTCGACGCTGGGCCGGCACCACTGCAGCATGGAGACGCCGTCGCGCTGCTTCATGCTGTGCAAGATA
CTTAGCTTTCCATATCTTGTACACATTTATGGCTTGCTCAAAGAACGAACTTTCCGAAATCTTCAGATGGAGTCGTAAACGAACTTTGCCTCTGTCTTTT
TCACCAGGACTGTGTGTAGCAATTCTGTAGCCGCGCAAATTAGTTGTTGGTAAATACAGAAGTTGGTACATGTCGTCACGGGGCTGCTGATCAAGAAGAT
CCATCAGCGGTATGCAAGCGGTGCCTAAATAGTTGTCGACGTTGTTACGGTCTTCATCCATCACCTTCACGCGAACTGTGGCTCTCATGATCATGTCAAG
TACCTGAGTTAGTTTTGCAAGTCGAAGCCGCTGGTACAGTCGCTGGCGAACCTTCTGATCCTCCAACTCCAATTCGTCCACCTCGTTGTTGAAGAACGAC
AATAATTTTTCGCCCGTAGCGACATCGACTCGGTCTTCCTTGGCGTCCAAGATATACAACTCGTTCAGCTTCGGCATAAAGTGAACAATAAACACTTCGT
ACAGTTTTAGTACGGCGTGACGCACTCGATGAGTGCATGTTGCCACATTGGCTTCCACAATCACCATGTTGTCGCGAAGCTGGCTATCATTCTCGTCCCC
ATGGGCATCAGATGACCAGGGAAGCCTTCGGTCAATGAGCCCCAACTCCTGGGCGGTGTCTTTTACAAGCGATTTCGTTTGTTGCAGGGTAAGTCGCAAC
TGGTCAAAAGCGAGAGAAGTCAAGTCAGTGCTAATTCTGTTGGACGCGTTTGGAGTCGACACAACTGCTGTTGAGGATCCAGCAAGCGTTGTTGCATGCA
GCTTGTTCATTGCGTCAAATATCAGCCGAACTTTTGTGATTTTTTGTAGCTGAAGCTCCATTTCAAGTGACTTCTCCAGCAGTATCTTCCCTCCACCAGA
AACAGGAGGCCCAGTAGCTAGAAAACTACGAGAGAGCTTGTTCTCATGCTGCTCAAGCGTCATTTTGAGCAGCTCCTTAGGGCAGATAGCCCAGAAATCC
ATGCTTTTTTCGAGTTGCTTGGCGTACACTTCGGTCTTTTCACCGTAACTTTTCATTCGCGTGATACTTAAAGAAATGGTTCCAACGACGCGCTTCCTAT
CCGATCCTTCGTGATGCACGCTGAAAATCGGTTCATCTTTAGGCTTGTCAGCATTATTTGTTGAGCGAGAGACGCCGATTTTTGCCATTGGAATGGTGAC
GATTCCGATCTTTGTGTTCGTCTTCTTGTCCCGTACAATCATCTTCACATCAGAAACACGATCCAAATCAATAGCAGGGTACGTAAACTTTAGCTGACTG
TCCGGCTGGAGCGCATACTTATTCTTCCAAGCCACTGATGTCGTTAATGGCGTTGACAGCGTTGTCCCTGCTGCCGTTTTGTCGTTTGTCAGTGAAAATA
CCGAGTTTTTCGGGTAAATCTGTTTGTCCGCATCCGGCAAAATTTCGCCTGTCGAAGAGAGCGCCAAACCAAATGGTGTAGTAACCTTCTTGTCATTAGC
CATGTGCTGCCGAAAGTCACTGGAAACGAGTAGCACTTCCACAAGCAGCCCGTCAGTTCCCATCTTTTCTTTTAATGTCATGTTACTCGCTTCCAGAACT
TGCACACTGAGCTTGTCGAACTTAATGTCAGCTCTCGGTACTTTCACAGCGGCAGTATTAGGAGATTTGTTAGCGCTCGTCTTCTGGAACTGAAGGTTGC
AGTGAGACGTGGCAAAAGGTCCAGGAGCAATGTAGGCTTTGTGGAATGGAGAGAGTTCTCTGCGAACACGAGCTTCTGCCAATACATCGTACATGGGGAA
ATGCAGCTCGTGAACATTTTCGTCGAAATCACGAACACTAACACGGATGTCATCAAGAGGTTCGAGTTCAAGTGAAACTTCAGGTTCAGAATCGAACCTA
CCCTCCGCACTAGTGAAGTCAACCGATAGCGCCATGCTGGGTGCTATCATTTCCTCAGAAGCAGCCAGGAGCCACGGCAATTTGCCAAGATCTCCGAAAT
CTGTCAATGGTTTGTCTCCTTCCACGGCAAGTGTCTTTTTGAGCTTTAACCGTCCCGAAATACCAGTGGCTTGTGCAAACGAAACATTCACCGCATCGCT
GATATTCCCGTGGTCATTGTGAGGCATCGATAAACGGAACTTAATCTCGATGGTGGCATTAGATAGCGCCACCCCCGTCAAATCGGCATTATTGTCGCCT
ACTGATGTGTTGTCAGAAGGCGACGGCATCATGTTTACGACCACACTGCGACTGGGAGTGTTGTTGAAGTCTACTTTCACAGCTTCGATCATTACAGTAC
GTCCTTTGCGATGAAGCTGAGGGTCGATGTTACACTCCGCACGCAGAAGTCGCTGAAGGATGAACACAGCCGAGCCAGGAGTCTTTCCCAGCGTAGCCAA
AACCAATGCCTTGAAGAGTGGGCCCGAATCGGAACACGAACTCACGGTGACAGCTCCACGAACTTGCACGAGCGGCGGCGGCGCCAAAATAAGGTAGAAG
CAGTTTTTCTTACTAAATGGTAGTGTGCCATTTGAGAGTGTGTTGTGCATGCGACGTTTACAAGCTGCGGTGTACACCAGCTCAAGCTTCTCTTCCTCTG
CTTTGTCGAAATTATCTCCTTTCACAAATCCATGGTATTGGCCTAGGAAACGTGGCTGGTCCTCGCTTCTCTCCACAAGAGCTGATTGAAGTAGCTTGTT
TGTGGTCGCATCGCGCGCTTGAATAGTTTTCACAGCAGAAGGAAGCATTGCATACACCTTAACAATTTTGTCACTACCCCACCAAAGGTTGTTCAACTTA
TCAGCCATGGTCGTGGTTGAAGACGAAGGCTGGGTTCCTGTTTTATCCAACGTCTGCAGACTAGAGCTGAAAACGGACCCCAGCAATGCCGTGTCAGCCG
CAATAAATTTCTGGCGTGTACGCAACTGAGATCGCTCCAAATTATCGACCAACTCGCCACTCTCGAGCAATGTGCTGTACTTCGCTGTAGAAGGAGAGTC
ATCGATTCGACTAGTTGGGTGATAAACACTGCTCACTCTTCCATCATACATGATTCCATCGGTCACTGGAAGTAAGCGCTCTCGTGTCACCAACTTCTCG
TCCTTGGGTTGCTGGCCATCCAGGTACACGATATCATATCGTGCATTACCATAGTTGTGGGAAACTCTTGCAGGCCGAGTAGATCCTGTCTTCGTAGAGG
TTTTCTGGGGAGTGGGGTTCGCAACCCCATCGTCAATTTTGGCCAGGCCAAGGGTCGAGTGACGCCTATCTCGACTCTCTTCCGGCGAGACGACCGCGCC
CCCGTTGACTCGTACATAGTCTTCTTTCTGTAGTTGTCCCTTCAAGACCCCGCCTTCTACTTGCGACAACGTAGCTTCAATAGAGTCGCGTGGTTGCCAC
TCTTCATGAGGTTGTAGGTGGTCGAGGTACTCAACCAAGTAAGGGCTTTCTGGATGCTCTTTTTCATCGAAGTGTTTTAACTTTGCGAGGCGCCCCTGTT
TAATGTCTCGAACCCGGCGATTAGACACTTCGGGATCTTTTTCATCATGAAGTGGGCATACAAACACAGTTTCCTCCATACCAAAACCCGTGCAGAGTTT
TATATCGTACCTACCGCCTCCCCATTCCTTGGCAATAATCGCGGCAATAAATTGGCCACCAGGTAGTTCCACGTCCACAGGCACTCCAGCATGCTTGAAC
AAAGGTAACTGAGCCGTGACTCGATCGCCAACGTGCAAAGGGCTCGACCGCTCTTCGCTATTGCGACCCGCACCAACTGAATCGCCATTACTGGAGGTGA
GACCACCACGAAGAGACAAGACATCGAACCCCGTCCACTCACACTCTGTGAAAAGCGCTTCGATCAGGCGTGGTGTCTTCTTGCCATGTAGGTGCCCAGT
CAAATAGTCTTTCGCCTCAGTCACTTGAGTGAGTACGCGTGACCATCGATTGAGCACTGCGTCCACAGCAACTGCATTTTCATAGGAGAGCCGATCTTTC
TCTCCACTTACAAATACGACTTCGAACACGTACGCAAGTAGTTGCGGTGTCACTTTCCAGTGCAGCTTGGACGCATGACGCATGATGCGCACCTGGGCAA
GTAACTCGTCGCCAATATTACGACCAGGAAACACGTTCGTTCGACAAGTATCCCACAGAAAGGTGTGGACATCCTTTTGAAGTTGCTCTGGCTCGTACCG
CCCGCTGTTTTGGTTTAAAGTCCGAGAGTCAAACACAAGTCCAACCAAACGGAAAGTGTCTGCCAATATTCTCCTTACGCGATCTGCCCGAAGAATTCCA
ATCAAATTGAGATCGAACGTCAACGTCGCTTTTTGCTTCGAATCTCGATCTGTCAGTACAAGCTTTTCATCTCGAAAGTTTGCACACTGCTCAGGGTTTT
TCAACGAGAATTTGGATTTGCTACCCTCCGCTTTGCCTCCTGATTTGCGTTCCATTTTCCGGTCTAATTTGCCAAGCTGACCCTCATAAACTCTCCCCTG
TGACTCTGAGACCAAGCGTACGTCAAAGTAATCCACTTTCGATAAGTCGTACGTACGGCCCAGGATGTTGTATGCCCCACCAACCGAGAAAGAATTCGCC
TGAAGTGATTTTCCGATTTTCGCGGTATCAGAGCTCAATAGAGGTGCTGCTTGACGGAGAAGTTCGCTGAACTTGTATGGGTTACCAACGCCGAGGTCTT
CTGAAGCAGGGTCGTATTGGATTCGCAATCCTCCTTCGCCATGAGGCTGGAAATAACACGTATACTCGTCCCAGTTTTCGTCCTTTAGGTCAACATCTTT
GATCGCCACCTCTGCAGAGTACGTTGTGTCGAGCTGTTTAGCATTCGGGTCCACGTAGTTTTCGTTGCGCATTATGTCCACCGAAAAGCGTAGTTTACCA
AGTAGTCCATCTGGGGCTGGTGTCTTCTTTGTTTTAGGCTTCGACTGACCTGTAGCTGGAAGTAGCATCGCCTCAACCTCAACGCGGCCATATTCATCCA
GCGTCAGTTCTTGCATAATAGTTCCCCCGAGAGCATCAGCCTGTTTCAACACGACCCCTCTAATATAGCCCGTTTCGCTTCGTTGAAACTCGATGGTTAC
GCAACCCAGTGGGTCATTAGCCGATGTTTGGTCGAAGTCCATCACACGAAGTAGCAGTGCCTTCTTATCCCTTAGCATGGTTTTCTCCGTTTTACCGAGC
AGGAATTCTTGGTTCTCCCACTTGGGGTTTAACGTCTTCATCTTGATGTCAGTTTTTAAGCTCGTATCCCGCTCCTTTGAGTCATCATCTATCAGGACCA
TCTCCACAAATGGGTCGCTTGTGAAGAGGTCTGCTACACGTAAGCTTCGGCCCTCCAAAATCGATACCTTCACGAAGGATGGTTCCAACCCCACTACAAA
TGGGATTTTCTTCTTGGGATCTCTTTCAGCGTTACCTTTCGGGGTCAGGTTCTTTTCCTGTGGTGGCGGCGGCGAGACCTCGCTTATAATTGCTTCAATA
AGGGAAGGAACCTTCGCACTGCGCTTGATATCTCTCTTGTGCACAAGCTTAAGCTCCACCCTTATTTGACCAAGGCGAGTTTTCTGAAGCATGTCACTGG
CAGGTGCAAGGGGATACCATGCATCGACCGTACGATGAGGTGATATCATCCGAATAGGGATCTTTAGAACGCCTAGCGGCTTGTGGCGGTATCGGTGCTT
CACCATGCGCGAAACACAATTCTCCAAATCTGTAGCCTTGAACAGAATGTTCAGATCGGTGCACCTATCACTAACTTTATGAGGGTCCAAATCTCCTTCG
CTCGTGCGAATCAGCTCCCGCATCAGCCCCTCCTCGACAATCCGTTCGTTATTGTGACTGTATTCCACGTCGTACAGTAGGAACATGTCACGCTGCGCTT
TAGGGAGGCTCAACCACGATGCTTTGTCTGTCACCTTGTACTTGGCCAACAGGCTGCTCAGCGATTCTGGAACCTCCATTTTGTTCGAGATATCGTATTT
TGCTGTGAACTGATATGTTGGATCGGTGAATGGCGTGCGAATCCGAACAATGCGTCCAGAATACAACGAGTCCCTCTTGAAGTTTCCACTTTGCATAGGC
TTGGACTTCAGGTTTTTGCCTTTGCCATAATATGCCATCACGGTCTCACCCACACACCCTGGCTTTTTCAGCTCTCTCCGCACTTGTGCACGGAGCTCGC
GCGACTTCTTTTCATGATCCTGGTGCGACAGCTCCCTGTCGTGCCCAAAAACACAATTCAGCAGCCGGTTGAAGCTTCCTTCAAGATCGTTGTGATCAAA
CTCTGTGGCGTGCTTAATACACTTTTGCTGCAAAATTGTAGGGTTCAGCCGCTTCATCAGAACCATTTGGCCAGGACGCATATCAACGCAAACGCCTGAG
CTTGTCAGCGCTTGGATCCACTTTTGAGTATGTGGGGTTTTAACTTCAATGACTTTGTCCCCCTTATCTCGTGTCCTTGCCATTTTGTCGAGATTTTCAG
CGGATATAGAAACGAAGTCTTGGGAGTCAGGCTTTCTGACGCACACTGTCGGATTCACAATATCCATCCATCCTCCTTTCGCATCGTTCGTGAAGTTATA
GGCTACTTTGCAAGCCGCACTTGCCATGTCAATGAAGGCCACCGGTGTCGTGGATGTTTCTTGCTCATACATGTACAAGTGCTTACGACTTGGAACGAAA
AGGCAATACTTCCAATCCCACAACACGTTTTCTGCATACTCTTCAGCTTTTTCAGCAATCGTTTCGGCAACGGGTTGTAAAAAAGAGTTTTTCCTAATAT
CAGGGGAGAATAGCGTACTGGATGCCAAGGTGTGCATGCCTAAAAAGCCGTCGCAGTGCTCAGTAAGTTTTTTTGCGTACGTCTTGCTTCGTTTGTTTGT
GATCTGCTCCTGTTCGCTTGAGCTATTGCCTGCGTTCTCGTCCACAGATCTGAGCACAGGTAAATCTGAAGCTTGGTAGCAATCGATTTCTTGAACAAGA
TCGATTGGAAACAAACTCTTTTCGCGTGACAGCTTTTCCATCCACATATCTACTTCACGCAAGCGGTAGAAACGATCCACCTTGTATTCCAGCAGTACTT
GCCTTTTGCCGAGGTCTGTAACAGCAGCAATCCCTGGAGTAACGTTTTCCACAAAACCAGCAGCACACAATGCACTAAGCCACTGCAATGTGTACTCGCG
CGTCGTTGGTGCTTGGATTGCGTCGGGATCAAACTCCAAGTTTGCGTTCCTCCACCCTAACCGACACGAAGACTCAAGGGCACTACCCCGGCAGTATTTT
GTCCACCCATCTTCCCAAAGGACGGGAGGGTGACGCAAAATCCAAGAAATCATACCTTCACCTGTGAAGCTCCGTGGGACCGACAGAACTAAAGCACTCG
TTTGGTCCCTCATGAAAAAGCTGCCGCTTTCGCGAAGGAGCCTCTGTCGATCAGCGCGCAGTTTGACCCATTCTTCTCGAGGAATATCAGCGTCAGGGAA
AATACGCGGGCCAGTAACTCCTGCCAAATCCAAGAGCTCATTTTCCAACCCGGCCACTACCTCCTTCCGTGCTTCTAGCGATAGCTTGTCCATCGTGCAG
CCGAGCCACTCGCTGGTCGGATCAGCATTCACGGTGTGAACTTGGCGACACTTACGCATGTCATCTGCGGAAAGCACCTCAAACTCTTCGAACTGACGAA
TCTCGCGTAAAATGCTTACGATCCGCTTCATGATGACCACGAGCACGGCGTGAAATTCATCGATTTGGCAATTCTCCGTGGGAGTCAGCGACGAACGAAG
AATTTGTCGTCGCTCAATCCAAGTCACTCCTCGAGTTAAGATAGATGATGATTGAGCTTCAATTTTCACTTGGCGCTGGTACCACATGCTCAATCCACAC
ACGGAGAGCCGGGGCTTAAAATCTCCTGCTTTGGTAGACGCTTGCATTTGTCGTGGCTTAAACGTATCCGACCATGTAGTGATACGAAGGAACAGGGATC
CCACAAACTTATAATAAGGCACGTTCGTCGTATCGGGAGGGACAATCTGCAAAGTTAAGTCCTGCTGTCCACTTTGTAGCATAGCGAGATCGACTTTCAC
AAACCCAACCGTTTGGTTACCTGCAGCGTCCTCGTTGTCCACACGAATCAGGATGCTCGAAGCCTGTTCGAGAATCTGATACCCCATCTTTATTTCATGC
GGCTCAACAGGCTGGTAATCAGTGTCCCCAGGCGGAGTGGCATCCACCCTACCCATTACCAAGGGTTTCTGCTGGAACAAGTGCACATCATCGGTCTCTG
CAGACCCATGCAGCACAGTAGCCGCCAAAACCTCTCCCTTTTGGCAGTTCCAGTTAGACAGTGTCACTGTGTCACCCGGAATGAGCTCACCTTGTTTGTT
AAAACGACACGTGCTGGATGCAACCTGTTTTGGGTTGCCAAGCATTGTAATTCGGCACGTAGGCTTGCTGGTCTTATCCAGTTGTTTGAACTTTTGCGGC
TTTCCGGCCTCATTTACAGGCACCAAAAGATCCGACGCCGATAAAACATCAATGACAATTCCAGAAAACTTATGCTGCAGCTTCAACCACCGCTCATCTT
CTTCTTTCTCCATGTCAAAGCGTCTGGCCATTACCATCTCGACCTTGTCCGTTAAACTGTTTATCGGAATGAGTTGAGTAGGCTTTACAGTGTACCGCAA
AGTACGCCTGGCTGAATTTGCAATAGCAGGTAGCTCGTTCTCAACGCTCACATCCACTCTACCATCACTGCGCACCGCCTGGACTGCTCCTTTTACATCG
AACGAAATTAGGTTACGAAGCTCATCGATTGTATCAACTTCATCTTCGAAATGGACATCGTATACATCGTCAGGGAACGGAATGTACTTCTGAACACGAG
CCGGGTAAAAGCGTCCACCATTATCGCCACCACGAAAAGCCAATATTCGTTGACCGTATTGCAGGATCTCGAAACCATCGTCATCAACCTCTCCGGATGG
CGTCAGTTTATGCAGTTGGAAGCGTTTAAGACGTGCGTCTTGCTTCTTTTCGTCATGGTTAAGCAATTTTGCCAGAACCTCCTTCTGATCATTCTGCAAA
TCTCGGCCGTATAAGTGAAGCGAGAGGTACGATACATTGGCAATATCCTTGATCTTCCCAAATACGAAATTCTCTTCTGGCCAAGATGGATCGCGTGTGT
TGTAGACAGTCAGACTTTGCTTTCGCTCGGCATCTTCCAGCCTCCCGTCGCCAAGGACAGGAATAATGGTGAAGTAGACATTTGTCGCGTCTTGAGCACG
TTCAGCGTTTCTCGACATTCCATTTGTCTGAGAATCGTGAACACCATCAAGCTCGAGTGAAGACGACCCAATATTGGCACTTCCTGCCGTCTCCGTGAGT
AATAAATTTCGAGCCTCGTGGACACGCAAGTGGAGTACATGAGTTTCACTGCTTGGGTACTTAGCATCACTGAAAACTCCAGGATACGACAAAGAGAGCG
CGAACTTTTCTTTGCGCCACGTTGCTGTTGTACCGAGAACCCTCGAAGTAGATGTCTGAATAGGCAGTCCGCGCTGGATAACTTCCGTTGTTTCGTCTTC
TAGCTCAGATCCGCCGATATCTGTCGCTGACATATCCATATCCATTGAAACTTCGCTTTGGATATTTGCTTCTGAGAAGGTGAGAATACTTAGTGACTTT
TCCATCGGGACAGTAGACACGCGTTGCATTAGCTCCGCCAGAGCGGTCGCATCTCCAACCACTTCGGTTTTTATACACAGCTCTCCCAAATCCTTGGCAT
GCTTTTTCATCCAAGGTTCTGGTTTAAGTTCATATCGTTTCATAACTGTTTTCGACGAAATTGAGGTAAAGCCCGCAGATGCCCGACAGAGATCATACAA
AGGAATCTCCACACGTCCAAGCGGGGTGCTCCTCCCAATATTGTTGTGATCTTTAACGTGGATCAAGAGTGACTTGGCATCTGAAAGCGGTACGCTCTGT
GAGAACAAACAACAGCAAGTCAATAGAGTTATTCGCACAAATCAAAAACTACCGCGTTTCACAACTTACGTTACCAAACAGGAAGTTCTCGTTAGTCCAC
ACTGGATTAAGCGTCTTCGAGACCACTGCTGTGCGCTTCTTTTCAGCATCGATAGCCTTTCCGGTTTGATCAGTGATAGAAAGTGTACAGTACGGATCGC
TGTAGCCATTCATGTCAGCCGGGCTGAGCCCGTGTCCCGTGAGGATTTCCACTTTCAGAACTGGTTTGTCAGGGTTAACCTCCAGCGATTTTTCCGATCG
CATTTCGTTCTTCACCAGTTTTGATCGGTGCAAGGATACTTCCGCCTGGGAACGTTTTGAAAACATCGTATTGCGTGCCTCGGATGCAGCAGCAGCAATC
CGCTTGCTTTTTTGCGGAGACAACGGCGCACTTGTACGTTTACACCCCTCAACGCATACGGATGGGTCGATTTCGATAACAGCGTACGGAGTCGCGGTAG
TCCCCGTATCACCACCTTGTTTTTGCTTCTGTTTCAGATCGGATGCCTCAATTACCGTCACTTCAAGTACTGCCTGGCCTTCCAAGCCAGCTCGGGCCTG
AAAGCCTTCATCGGATGATACTTTCTCTTGATGAGCACGCGGAATCTGAGAGTTCAAGTAATGAATGCAACCGTTGATGCCATAAAAGCGAGGATCCCGT
GCCTGGTAGTCGGTGACAGCACACGGAATACGCGCCCCATCGAGCTTACAAGCAGCATCATGCAGCTGGAACTGGGCGTTTTCCAACTCGAGCTGCTCAA
CAGAGATGTTGTGTCTTTTCGTGTTTAGCTCCTTTTCGATCTTCAGCTGACGAACATGCTCTCCACGTCTCTCACCAATCAACCAGATTTTTAGCTGTAT
CGCACCAAGGTTTTCGCGAACCGACATGCCTTCTTCAGGTTGCAGTACGTGCCACTCTGTCCACTTGTGAGCCGAAAGCTGATCCAGTCCAATGTGAACA
AACCCAAGGGGGTCATTTCGGTTGGACTTGTCGTAGTCGACTACCCTTACTTTGAGGCTGGCTGCCTTCTCAATGTGGCAGATCAATCCAAACACGTGGT
GCTCGTCAGCCCATGCAGGGTTACGCGTCCGATGCATGATTGCAGTCGTGGCGTATTCTCCAGGGATGGGTTTTCCATGATCATCTAGCAAAGAAAGCTC
GCAGTAAGGATCCGACGAATTGTTGAGGTCGGCGCTGATCAGGTCCCTCGCAGCTATAACAGTCACTTCTAAGCGGTTATCTGTGTGCTCGTTACTTGCC
GTAGCCACAGGACTTGTCGGAACGAAAGCCAAGTCTGAGCTGTGGAAGAAGTCAACAAGATTGGGCCCAGATATGCTCATCTGAACGCGCAGCTCTCCCC
AGTCCTTCACGACGTGTTCCTTCTCCCGGGTATCATTGCGTCGAGGAGACGACGATAGACCAGTTTTCTTCGGCGGCTCCACACGAAACCAGTCGTCGAT
CGGCTCCGACTGAGCCGTGCTTGCTGGGGACATGCGGAACCTCGAGAATGGCACCTGGACTGACCCCAAGCTGTCGTGACGCTTGAATGTATCATGATCG
AACAAGTCGAACCGAATAGCCTTCACTGAATTCAGGTCGACAACTCTGCCAATCTCGAACGGCTTCCTCCACGCCGGCTCGAGAGTTGCCGGGATCACCT
CAGTGCGTTTCTCCTCGACGTCGATGACCTGTCCATCTTTGCCCACCAGCTTTACGACGCAATACGGGTCGCTTTTCCCGTTGAAGTCTGCAGCTTTCAG
TTTGCGAGCCTCCTCTACAACAAGCTTGAGTAATATACGCGAAGGTGGGGCTGGAGCTGCAGGTGGCTGAGGAGGCGTCGGTCCTATCGAAGGGGCAGAT
TCCTCCTTTGGCATCTCGGGGGCTAGTGTCTGCTGAGCTACATCAGGAGTCCGGCGGTAGGCGTTGTAGATAGCCGTAATCCACTCGTCCTTCTCGACTT
CGTTCTCTGCCTGCATGTAGAAGCTTGGTTGTCCAGGTGCAGGCTGGAACAGGATGCAGAGCGGATATCCCTGGTCATTCGTCCGGAGCACACTTGTATC
CAGCGTAAGCTCGTAGCAGCGCCGTGGCGCTGTGTCTTGCGGCGTTTTGTAGTACAAGAGCTCGGTGCGAGTCAAGCGGAAGTACCTCCGCCGCCAGTTC
GACACGACCCTGCCCGACCGGCTGCGCTTCATGAGCCATCCCTCCTTGATGTAGCGTTGGTCACTCATCGCGGGGAGACGGCAGCGACTTACTTGTCTCC
TCTGTCTTCCTAGTGCAGTTCTTCTCTACTTTAGCCCGCCGTCACTTGCGCGCTCGCTGTCTTCTTATCTTCTGAGGTGTCCGTGGCCAAAGATCGCGAT
CACCTTGAAGCGTCGTCGCGTCCCTCTGCGGACAGCTCGGGCGGTTACTTGATCCCGACCAACTTGTCATGCATTTCGTGCTGCTTATCCGATAAAGCTA
CGACTTGGCTCCTTTCTGGAAGAAAAGCGGTGGCGGGAGCTCTAGGGGGAACAGCAACTCGCTTTTGATAGCATTTACCGGTGCATTTCGAGAGGACGTT
GGCTCTCGGCCGGAGCGGTGACTCATGCGTCGCGGACTCGTTGCACCCTTGTTCTGCTTGTAGTAAATCAGTTTCCCCTCAATGCTGGAGCTCGAGCTCT
TGGTCGTTGGCACCTTCGCATCAGTCCGTACGGCACCAAGTTTGCGACTGCCTCTCAGCGCCGACTCGGCTGCTCTGTCCTCGACGAGTGTATTCTCGTC
ACACTGCACACTCGAGTCTACCTTCTCCAGCTTCTTCTCCTCGTCGCTGCATCTCTCCTTCTCAACTCGCTCTACTGCAGTCGCTGGTCGCTGCGTCTGC
TGCTTCGTCTCGTGTTCCACCCGAGGACTCGACGGCTGCGACCTGTTCACTTGTACACCGAGCGCCTTGGTGATGTGCGGGGCCAGCGCCTTCCCGAGAC
ACGAGAGCGTGACGGCTCCAACCACGTGCCCCACAACGGCGTTGCGGTGGTCTCGGAGCTCCCACGAGCCGCTGTGGCTCGCCCACTCACAGATGCGCAG
CAACCTGCTGCAGCTCAGCACGTCGTCCTCTAGCCCCACGTTAAGAGGCAGCGGGACAGCTGCAAAGGCTCGCAATCGGGCCCTCCCGCGCTCCTGGAGC
AGCAACAACAACGTCAGCGGCGCCTCCGCGTCCTGTCGGAGCTCGCGCACGAGCTCGTCCGGCTCCGCTTCGAAGAGACAGGATTTGCCATGCTTGAGTC
TCGTCACACAAGCTTCACTCTGCGTCTGAGAGGCCTTGGAGGGCGTCAGCGGCGTGTCGAACACGACGATCTCGTACTGTAGCAGCTGAAAGCCCAGCAC
CAGCGCGTTCTCGAGCTCTGCACAGGACGGTAAGGCCGTTAAACATACTCGGTCCACGTAGAACTGCAGCGAGAACAGCACACAAGCAGGTAGACGGGCA
GGAGGTCCACTGAGCGCGTCGGAGTCGCCGGACGTCACAGAGAGCGCGCCATCTTCAGCGTCCATCGATTAACTGATATAATAGCGGTTATGTTAATGTG
TCTGACCTGTCAATACCGATACTTGAAGATATCGTAAACCACAGGGCATGCCAATGCATCATCACCTCACATTTCCAGCAGCTTCCGTCATGCTGCGTCG
GTTCTCCTCGTCGGCGGCGCCGCGCATGGTGCAGCAGCGCGTGCAGAGCCAAGTATCGCTGCTGTCCAAGAGCTCCACTGCACCCAGCACGCGCGTCGTG
TTCGTGTCTCGTGCTGCCGCGTCCGACGTGCAGAAGTCGCTGCCGTTCCCCGTGTCCGCTGCTGCGCTGCGCGACTTCCAAGCCAAACCGCTCGAGCGAA
TGTTCCTGTACCCAAACGAGGACGACGCCACGCTCCAGACCCAGCGCGTGCTGCTCGTAGGCCTCGGAGACGCCGAGAAGGTGACGCCCAATGTGCTGAG
GAACGCCACGCACGGCGCCCTCAGCGCGCTCAAGGCCAAGCGCGCCTCGAGCGTCGTGTTGCAGGTGCCCAGTCTGGAGGGTGGAAAGATGGACGCCGCT
CGAGTGGTGGAGCTGATGTCCCAAGCCTCGATGCTGTCTAACTACCAGTTCGACCAGTACCTGACGGAGGCCAAGGACGTCTACGGAGACAGTAAACTGC
GCCTGCCACTGGAGCAGATCTACTTGGACGCGTCGGCTGAGTTCCAGAAGGTCAAGTGATTGCTGGAAGTTTTTTTGTAGTGTTGAAGGAGACTGACCAT
TGAGTGACATTGCAGAATGTGGCGGAGCAGGCGACGGTGGGCGAGGAGACCATTTTCGCGCGCAACCTGGGTGCGTACTGATTAAGAGTTGGCCACGTTG
TAGTTCTGGGCTGACTTCGGTGATGCAGGCAATGAGCGCTCGCACATCGTGAACCCGGCATTCATGGAGGAAGTGGCACGTGCTTCGGCCGAGCTCCCCA
ACATGTCCGTTCGTGTGCTGCAGCAGGAGGATCTGGAGAAGGAGGGCATGAACATGTTTCTGAGCGTGGGTCAAGCTGGCATCTGCCCTCCTCGTCTGGT
TATCCTCGAGTATCGTGGCAACCCCGAATCCGACGAGAAGATTGCGCTGGTGGGCAAGGGTGTCACGTTCGACACGGGAGGCCTGAACCTCAAGCCTACG
GGTGCTATTGAAGACATGCATACTGACATGTGTGGCTCGGCTGCTGTGCTGGGAGCTGTCCGTGCCGCTTCGCGCCAGGGTCTTAAGGTGAACATCGTCT
GCGCTCTTGCTCTGGCCGAGAACGCCATCGGATCAAAGGCCGTGAAGCCACTTACGATTGTCAAGTCGCACAAGGGAATCACCGTGGAGAACAACAACAC
CGATGCTGAGGGCCGCCTGGTCCTTGGAGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCCCAAGAAGGTTATCGACGTGGCTACTCTGACTGGTGCG
TGCATGATCGCTCTGGGTGAGCACTGCGCTGGTCTGTTCTCCAACTCGAATGACCTGGCCAAGAAGCTGCAGGAAAGTGGTACCGAGTGTCACGAGCGTT
GCTGGCGCCTGCCAATCCTCCCTGAGCACACTGCCGCGCTTAAGGGTACCCAGTCGGACTCCCGCAGCACCGGTCGTGTCCGCTACGGAGGCGCCTCCAC
GGCTGCTGCTTTCCTGCAGCAGTTTGTTTACGAGGGCGTGGATTGGGCTCACCTTGATATTGCTGGGCCGTCAAATTACAGCTCTGCCAAGTCGTACTTC
CCCAAGGGAGCTACGGGCTTTGGCGTCCAGCTGCTCTACAGCTACTTGAAGGAGCACGAACAGCACTAGAAGGTGCTATCTGCCGCCGGTTTTGTTGTTA
CTCAATAGAAATGGCAAACAGGAAAGGCGTGTTGAAGATGTTAATGGTGGTTAGTGCTCTGTGTACAGATTCCAAACGAAAACGCAGCCATCATCACCTA
CAGAGACAAGCTGACGATCGTCTGGGCTGAAGGCGAGGCCGCGAACATTGCCCGAGTGGCCTACGCCGTCCATGATCAACTGGTTGGTGTTAAAGTCCCA
GACTTTCACGAGTCGATCGTTCCCACCGGTGGCAAACACTTCGAGATTGTGCGCTACAGCGATGCAAGTGGCCTCTTCGTCGTGGGCCTTCTGGATCACG
GTCACAGGTGTGTCGATGCGCAAGTCCCAGTAAGATATGCGCTTTTCCTGGCCAGCACTCAAAACTAGGTGTTGGTCAGCAGACAGCGCCACAGTGTTGA
TCCCGCCCATGCGCTGGATGTGACTTGAAATTCTCCGTTCATTGCGCAGGTCCCAGCAGAGCAAACTGCGGTCTCGACTGCAAGAGATCACGTGCAGATC
GTCGCGATACAGCGCCAGACTCGTGACTGTCATCGAGTGCTCTTTGAGGTGTGAGACCAAGTCGCGCTTGCGAATATCCCACACGCGTACTTCACCTCCA
ACCCCCGCGGACACGATGAAGCGCTGGTTGTGGCTCAAGACAAGCGCCGTGACTCCACCTGTATGAGCATTATCAATGGACCAGGCCAGGTCACCAGAGT
CGCTGCTATGAGACCGGATGCAGCCATCAGTCCAACCTGAAAGAAGCACGTCTAGCGAGTACTGGAGAGATGTCGGTGCTCCAGCATCACCAACCATGCA
ACGGGTTGCCACCGAGTAGTCGGAGGCATCCCATACTCGAATAGTGCAGTCTCGAGAGATTGTGGCGAATCGGTCGGACACGTCTGGCGCGTATGCTATC
TGCACGACAGCGCTCGAGTGGTTTTCAGACAGCAAGCCAGCCTGGAGACTTCGTTGGGAAGTGCCGAGCGCGAGACGCACGGAGTAAATCCCCCCGGCTT
GGGTGCCGGCAACAGCCTCATTCTGTGCTGCATTCAGAGCTATACCGACGACGCCGCTGTCTAGGCCAACGTGGCAGGTGTCCACGAAGTCGTGCCCGTA
GTGCAAGACACTGCCATCCCCGCCACCTACAAGAATACCGCCATCGAAGTACAAAATGGAGTTCACGCCGCAGGAACAAGCCGGAACAACCTTGAATAGC
TGCCGCGTTTTCACACCGACCACGCAAAAATCGCCACTCGAGCTGCCAGCAATGAGGGTCTCACGGTCAGGCGAGAACTGCACGCAGGTGTAATCACGAA
CGAGAGTCTGCTCGATTTTGTGCGGCATGAGCTCACCCGTGACAGGATTGAGGACCCAAATCTGCAGCAATCGGTGCCCGACTGTAGCAAATTGGTAGTT
GGCCGTGTCGCGGCGCTTTACGTCACGCGCCATGCCCCCAAAGGCAACCGCTGTGACGATGCTCGACATCTTTTGGTGCGTGGCGCAAATGTTACCTGTC
AAAACGTCCCAAATGTACAGCCGGGGGCCGTCCTCAGGAACACCAACGGAGCATAACAGTCGCTCGTCATCCGAGAAGGCAAGTGCAGCGATACCTGCGT
CGTGCTCAGATAGTCTAAAAGCTAGCCTGCGGGCTGAATAATCCCACACCAGGATATCTGCACGCCTGCCACGCTCACCCGAGGCTAGGATTCTCCCCGA
TGGAGACATGGCAATGCAGGTCACATTACCCTCATGACCGCGCAAGAAGACCTGGCTGTGCGCGTCTTGGAAGGATGTAAGCAGCACCGAACCACCAGCG
GGATACACGTAGTCTCGGCCTGCAGGGTGATAGTGAATTGCGTTTGGTACGGCGGAGAAGCCAATGGTGTGCTCCAATTCAATCACGGGCGACTGCTGCG
GCTGCTTCTCCCGCCCTCTTGAGCTCGACTTGGTGGTATCCATCAGAGCAGCGCCTTCGTATCCACGCATGTTGTTGCCGCCATCATACTGCATTATGAC
AGACGCGACTTCTTGGAGCAATCAGCAATGAGAACTTCCCATAAGGAAGAGCCTCTAGCAACTGCCGACCGTGGAAAAGTAACCACTAAAACTAAACATA
TATCCCGAAGTTATTTACTCAAGCTGTGTCCCAGACTCGAGGAGCCCCGTGGCGCCAACATAACTCAAGCACGTGTAGTACGGAGCCAGGTCGTTCTCGT
GCATCCACCGGGCGACGTCCAGGCCAATATCCTCCTGTCGGTCGAACAGATTCACTCGCAGGACACCTCGAGCCAGAAACACTCGGGAAGGCAGCTCGAA
CGTTTGCATCTACAGTTAGCAGTGGTAAGCATTTCAGTTGTCATACCCAGCTACCGTTAGGATAGTGCGCTCGCACCTTCATGTCCTTGACAATGCTGAA
CACCATGGACTCGTAGACCAAAGAGCCCATCTCTCCGTCTTCTTCCAGCTCGTACAGCGCGAACGACAGCCGCTTGGGCGAGTACGTCGGGCTGCCGGGG
TACCAGAACACCCTGTACGGGACAATCTGCACACTGTTCACCATGGAGTTTTCCCACAGCGTGTAGTCGAGATAATCCGTGGTCGCGTATCCCCACGTCG
AGGCACTGGCGCAACACAAACACCAATGAGCTTCAACAAAAGTCCCATCTTCTCGATCCATCACTCGTCTCACCTGCTCCAGTAGCACGGACGGCCTCTC
GCACAGCCGCACTCAAGCTGCAGCCTCTTGGCGATGGCTTCGAACGCCAACGGGTCGTCCACCACCACCGTATTGGCCAGCAGCGCCACACCAACGCCAC
AGTGCGACTTCGTGAGCGTGTTCTCCGCCGATTCGTTCGTGTGGTCCACCGACGAGCACTCTACAAGCAACAAACAGTCTTAGATTCCCTTCCTCCTCCT
CATCCTCCTCTTAGCACCAGGCAGCACCTCGCACTTGACGCAGCAGCGAGAGATCTTCGCCCACGGGGCTCTGAGTTAGCAGCGCCAATCGCTTCCAGTC
CGCAGAGCTTCTGGTGTGGCAGCCAATCGCGTACAGCGCCATACGCCGCGCCAGGAGTTGCCATGTGTCTGTCAGACAACAGTATCCGAGTCAGAAGAAG
AAGAAGCACGTTAAAGAGCCAATTGAGCACGCACCACAGCCCACGATGGTGTCCCGCACGCGGCGGTTCACGGCCTCCAGATGCAGCAGCGACGTGTGGT
CCACGAACTGCAGTATCGCCGCCAGCATGTCGCTCGGCAGCTCGCACAGCCCCATGTGTGTAGCTTCTGGGCGACAGTTGAACTTCTCAGTGCCCGTACA
ATGCTAGCTCTCAAATTGTCCGTAGGGTGATTTGGACTAAATAAATATGAACGGATATGAAAGGGTATGTTAAGAACACGTCTGAAACCTTCGCAGTGAC
TTTCACATCTGCCAAGTTGAAGTTGTTGACAACATGCACAAGCTACATTTCGTGTTTTATCACTCCTTGGCTCTCTCTCTCTCTACATGTACACTTGATC
AGTGAAGTCGGACACATTGCTGCACGTCTAGTCGTCCCACTGATTGAGCGCCTGGCGGAGCATGCGCTGGAACTGCGATGAGGCGGCACGCTCCTTCTCG
ATCTCGACCCGGAGACGCTTCATCTCGCCCACAGCGCGGTACTTCTGCAGCGGATCGTCGATTAGGCTCAGACTCGAGCCTGCAGACTTGTTCCCAAAGC
TTCGCCTAATGCTCTGCACGGAAACCTTCACGGGTGGCTGCTTCGTGACGATTCGGTCGCGCTTGGGGCGCTGGCTTGAGACGTGGAGCTGCGTCGGCAG
TGGAGAGTGTACAGCATCCAGAAGACTGGCAACGCTCGAATTGAACCCTCGCCAGTCCGCGGGGTAGTAGATGGCAAAGTCGCTCAGCGTCTCGAAGAAG
GTCTCGTAGATCTCCTCAAAGATCTTTCGCCAAGGCAACAGGACGTCCGCCTCCTCCGGAGTCACTTGATTCGCGCTTCCGTCCACGCTCTGCATCAGAC
GTTCATGCACCGGGAGCAGTAAACTGTAAATCCGCTTCTTGAGTTCATACGTCGACACTGCAGTGGAGGCTGGATACGAACGGAACAGCCGATCGACGAA
GTCCACGATCTTCTTGAAGTAGACGTCGCAGAGCTGGTCGCACTGTACAGTGGAAGGCTCGATTGCGATGAAAGTCACTTCTAGCGCTGTCAAAACCGTC
CTGATCTCATGCCGCTTCTCTTGCGAGTTCCAACCGTGCGGGGGGTCCACGACAACAGACTGCAGCTCTGGTGGCGGGTACGCTAGATCCATTACGCCAG
ACGACAAGATGTCTTCACGTACGCGCGGGAAAACCGCACAAATTTGGCTCTGAATACCCACTGACGATTCGTACTGGTTCATCATTGCCTTGACACTACC
CTCCAGCAGCTCTCTCAGACCAACACTCTTCAGATTATGAACGGGGGGAGACAGGGATGCAATCTTGGAAACCACTTGCCTGAACTTCTGGGGAAGAAGC
TCACCAGCGTTTACAAACTCAACGACAATGTGGACAACTTGCGGGGCAAATTTGCTCTGCACTCGTTCGACACAGCTCTCAAGCGTACTTGTGACAAGAG
AGCGCAAGGACCCGATTTCGGACGAAGCAAACCCCAACACAAGCACACTCACGCGACACCCTGGTCTCAGTAGTGATAACAAGTCTCCCAGGCGCTGCTC
CCAGCTAAAAGAATTGCCTGCTTGCAGCAATGTACTCAGGTCAACGGGAAGTAGGACCGCGGACGTTGCAGCGAGCTTCTCTCTCTGTACCTCACCACCG
TTTCTCTGAGTAAACGTCGAATCAAGATACCGACAGCACACATCCACGCCCTGGTTGGACTGAAAAATGCGATGGCAGTCATGCTGGGGTGTCGTAGCAT
CTTGTGTTCCAGCCTTGACCGCACACCACAAGCCAAATGACGAGGAAGCTCCATCGAGAAGATCCGCAATCACCAATTTCCACGCGATCGATGCTGCACC
GGGGTTCACAAGCCGAAGAGGAGCACAGACCAGTCCTAGGATGTCTTCGGAGCTCCAAAGTGACGATACTTCTGTGTCCGAAAGCGGTGAGTCCCCTTCC
GACCTAAACGCTGGCTTCAGTCGCTTCGTACCAATAGATACAACATTGGTCCCTCTGAACAGCCACTGCACACTGTCTTTTGCCTTTTGATGAGGTCGCA
CTTGCCGAAGTTTTGCTGCATCGATGGCAACTGGGCCAGGGCCGGTACGTGAATCTTGAACGTACTTCTTCCAGAGATGCAATCTCAGTTTCAGGACGGC
GAGCCTTTGCATTTCGGCGCGACGCACCCGCTTTCTTTCGGCCCGCTCTTTCGCCAATTGCGCTTGTCGCTGCGCTTCAAGCAGTGCCTCGCGTTCCTGG
CGAGCTCGTGCCTCCGCTAGTTCTTGCTGGCGACGTCGCTCAAACTCTTCTGCAGCCTTCTGCCGAATTTCTTCTTGCCGTTTCTCTTCTTGCCGGCGTC
GCTCGTCCTCGACAGCCTTTATCCTAAGAGCTTCCGCTCGCTGCAGTGCTTCAAGCCTTTGCTGTTCTGCCTCACGCGCAACTTCTTCGGCACGTCTGCG
CTGCTCTTCGAGTTCACGCTTCTTCTTTTGTTCCCGTAGTTGAGCTTCGAGTTCTTCTTGCTGTCGCTTTGCTTTCTCGGCCTGTTTTTTTGCTTGAGCG
CGTGCAACAGCTTCCTTTTCCGCGTGTTCTTCACTTTGAGCTGCTTTCTCCACCGCATCCTTCTTAGCTTGATCTTGGCGCACCTTTTCTTCCTTCGCTT
TCTCTAGTTCTCGCATCCGCTCCAGCATAGCTTGCTTCTTCTGTTCAAGCTCCCATTTTCTCTGCGCAATCACATCGAGATCGTGCTTTTTGTGATCGGT
TTCTGCAGGCTGGTACTGAGTATTTCCGAAGCTCACAGAGATGTTTGAAGGCGTTGGTGGAGCACTCGCTGGAGGCGCCGCTGGTGCTCCGTCATTGTAA
TCAACAAAATAAGAGTAGTCGTCCTCATACGCAGGTCGATTCGGATACAGCCTTGCTTGCTCCTCTCGCTCGGAGTCTTGGATCAGCTTACTAAGCGCTG
GGTATTCATCGCGTGCGTATTCGGTCACACCGCGGCAGATATCTCGCCGAAGGTAGTTGCTGCATATATCAAAAGATTAACTACGGAGACACTTCGCAGC
CACAAAACTAAATAATCCGTACCCTTGCTTCATTCCAACGTAAATCTTGGAACTTCGAATCTTCTGGGGTGTATTGTTCCGCCGTAGTTGCGCATCTGCA
CCATCGGCATCATATAACCATAAGCACAAATGCCACCAATCGCAAGCCTAATAATCCATAATGTACCTGTCTCGAAATCGCCACCGAACTTCACAATCAC
TGCGCTGTCGTCACCAGTTCCAGGCCTGCCAGCTATCCTCAAGCCATGCTCTTGGCACACTGAGTAGGCGTGCTCCATGTCATCAAAGCACAGCAATTCA
ACCAAATCCTCTAATGGATAGACCTGGCTACGATAAGCCCGGTTCATACGAAGCAGAGCTGATGACCGGGCATTGGGGATGTACCGAAACAGTAAACATG
ACTGCAGGTAGGTTGCTTGACGAAGCAGCGAGAAAAACTGGAAGTAATCACCCGTGTGCCGAGCAACAAACACGCGCATCGCGAACTTGATGTGTGGGCT
CTCCAAGATATGATGCGGGAGAACCTTAACATACTTCAGCACATCCATACCGCGGCCATTGTCCAGTGCACACAGGATAAAGTACGCACGACATTCTGCC
TCAAATGGACTCAAGTACGCGGGATCTCCAACCTTGCGACTTTCATCATACAACTCGTTGAGCGACTTGAGAGTTTGGCCAAGCTGCTCCATATTCTGCT
GCGCCACAAAGCTTGGTGTCTCGATGAGTTCGTGCTCACTGAGCACGTGGTATCGCGCAATACGCTCATGGATGTCGAGAGCGATGGGGTGTACACGTCC
TCCAGCGCCGCGGTAATTCTGCAACACGAAGTCTTTTCGAATCATTCGAAACCGATCCCAACAGAAGTTATACAACTCGATCGGGCCCGGAACTCGGGGC
TGCTGAAAACGTGGATCCTCGCCACATTGGTCCAAGTCCATAATTTCCTGCTCGATGTAAAGTTGAGTGCGTCGAAGAACTCCAGGAGGGCGGATTTCCT
CTGGAATATCCAGCTTATGATCAGCTGAACTGCGTTGGAAGCGCTTGATAATCCTCTCGCGTTCAGTTCCTGGTTGGTTGGGGAAACACTTTTCGAAGAC
ACTCAGCTCATCCACCCGAATGTGCAGCTCCCGTTCTGCTGGGCTACACATGTCAGCGCAAAGTCCATTCAGATTAGTAGCGGCTGAAAGTTCTGCTTTG
CTGCTTTCTTCGGTGGAGGCCGCAGAAGGCATGGGGGCGTATGAAGTGTCTTCATCGCTCGTACTCGGCGTTTTCTTCTTTGGCCGAGATTGTCGCTGCT
TCCCATGCTTTTCATTAGTTGGGCTTACCTTAGGCGCCTTAGCAGCACCAAAAGCGTCTCCTCCAGCAGGAAAGTTTCGACTTGACTTAGACTGTTGTCC
AACGAAGGGGTTAGCATCGCGTTCTCCCGAGACACCAGCTTGTTTTCCTTTCTGGAACGGCGATTTCTTTGCGCCACTCATTCGCGCCTCCATGGAGACC
ATCTTGTCTGAATTTCCAAATCCTCCTGCGGATACGTCTGAACCAAACGTTGGCGTAGTCTGTCGTCTCTTATCGGTGACACCACCGAACGTGGTCGCAG
GAGGGCTGCCAGCAGGAGAGGGTTTCCCGAACGCAGGAGACCTAGAGCTATTACTACCCGCAGCTCCGCCAAAACTTGTATGAATAGCCGGAGCATTTGG
TGCACCTCTTCCATTACCCGCCGTCGCAAAATGGTTGTCCGATAGCGAGGAAGATGCAGTGTTTGGGGTGATTTGCTTTTTTCGCACTCTCGCACCAGAT
GCTTGGCTTCCGAAGGAAGTCCCTGGCGTCGACACTGGTGCCGGTGCTGCTGTACGACCCGACCCAAAACCATTCGAATTCTGCGAGAATGATCCCTGTC
CACGCTTGGGCGTCGGCGCCCCAAAAGTAGTCTGTCCTGCACCTGGCGATGACAATGGTGCCGGTGCTGCTGTGCCACCCGATCCGAATCCGTTCGCGTC
TTGCGAAAAGGATCTCTGTCCGCGCCTGGGTGCCGACGCCCCAAAAGTAGTCTGTCCTGCACCGAATCCATTGTCGTTTCCTCCAAACGCTGCACTGCTT
CCACCGAAAGATGCCGATCCATTGCCACCAAACGCAGTCTTCGGTGCATTTCCACTATATCCAGTCTCTCGATTCTTGGGCTTTCCACCTGTAGACGACG
AAAATCCAAACGTCGTGTGTGCACCCGGTAACGTAGAAGAAGTCGACACGCTATTCTGTCCAAACGTAGTCCCTGCACTATTGTGTGCCTTGTTGTTGTT
GTTGTTGTTGGTTTTCTTCTGTCCAAACGGGTTTCCACCGGTCGAAGTGGCTCCAAACCCGCCCGACGGAGCTCCAGCCATTCCTCCGGGAGGAAGTGGG
GGCTGATGTCCGAAGCCTCTGCCCGGAGCCCCAGCCATTCCACCAGGAGGCAGTGGAGGTTGATTGATAAAGCCGGAGCTCTGTCCGAACGCGGTCTGGG
CCACTGGAGCGTTTGCATTGGACTGGAACTGGTTCATCGTTGAGGATCCTGGACACGCCAAGGGCACCGATCAATACCTAGAGACGCCTAGAGACGCACA
CACAACGAGAGCAGAGCAAAGCGCGTAACCGTAGCCATGTAACCTCCGTACCTTGACTCTGCGCGAACGGGTTACTGCTCTGCGCCGCGAAGCCGCCGCC
TCGATCTGCACAGAGTGGACACAACGTATCAGCTTGTAACTCGGGAATCACGTGGCCAATGGAAGCGCAAGAAGGTGGAGAATAAAAACGAAAAAGTGGA
GAACGCACTTCCGGAGCTGAACATGCCGGCGTCGTCCCGAGAGCCGCTGCGTCGTCGCTCGCAGGTGTCGTCTGCGGTTCCTGGGCCCGTTGGGAAGCTG
AACAGGGGGAGATGCAGCTGCGGTACCATGTACCGTTATGCGGTCGTGTGGCCCACCTTATCTGGAAATCCTAGTTCAGGCTAATGCGGTCTAGGTTAGG
CAAGATGCTGCGATCTGATTGGCTGTGAGGTCAAGGCATAGTGAGCCCAAGTGAATGTCAGGACTGGAGAGCCTTGCGCGTTGGGGAACCACCAATTCTC
GGGCGCTGGCTCCGCCTGCGATTGTTGGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAACTACGCCCCATGACGGCGG
CAATGACCAGCGACTCACACTGCGCCTTCCTCTCTCTGTGTATCGTAGTTCAAGATGGTGAAGCACAACAACGTTATCCCCAATGGCCACTTCCACAAGT
ACTGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTAAGACAACAGCCATGACGAAACTTTTACAACCCCCAGCGGCTAGATGCACACACACCCCATTA
GCTTCTTCAATCCGTCTGCCACCATTGGACAAAACGTCAGAGAACGAGAACAGGTCGACTGGAAGGGGACAGACAGTGGATCTCTCTAGCGGAGACGGAT
TCAATGGGCGTGTGGCGCTTTAGCTGCTGGCTGCAGACAACTACGAAGGATCTACGTACTGATACAAGTGACATTATGTTGTGACCTACCAATAGGCTGC
CAAGAAGAAAACCCGCCGTCTGGCACGTAAGGCCAAGGCTGCTGCCATTGCCCCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCACTGCCCCACG
ATCAAGTACGGCTCCAAGGTCCGTGCTGGCAAGGGTTTCACGCTGGAGGAGCTGAAGGAGGCTGGCATCAACCGCAAGCAGGCCATCAGCATCGGCATTG
CCGTGGACTTCCGTCGCACGAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGTTCCCGCGCAA
GAGCGTGAACAAGCCCAAGAACGGCGACTCGTCCCCGGAGGAGACCAAGAACGCCGTGCAGTACACGGGCGCGATCCTCCCGATCACCCGCTCGAGCGTC
AAGTCGACGACGGCTGTCATCACGCCCGAGATGAAGGAGAAGAGCGTCTTCACGCAGCTGCGTGTGGCTCGCGCCGACAAGCGCATCTTCGGCAAGCAGG
CCAAGCGTCTGGCTGACAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACACGTGCTGGCTTGCTCTCTCAGCCGACTTGCTGTTGAGAGGGTGGGCA
ACTCCCTAAGGTCTTTTGCGGAACGTTGGAACACAATATATCGCGCATCAAAAAAGCTCGGTCTTCTTTTTTGCATATTTGTGTTTGAGGCTTCGTGTTG
CAGTTTAAAGGCAATATCGTTTAGACTTGGTATTTGACCACCTAAATCTACGTGTTCACACTCTTACGTCGGCATACGCCTCTGGTTCCGACAGTAATGG
TTGTTGCTCTGGTTCGTCGGACAGCATGATGGACTTGTACTTCACTGGTCTTCCCACCAAACTGTTGTTTTCTGAGGTGTCAACCTTCTCGGGCAGCACG
CAAAGGAACACCAAGACGAGCAACTGGCCGACAGACGCAATCACCACGACCAGCCACAGATGGCTCCAGTCCACAACCTTTGTGGTCGGGTCGGGAACAA
TTCCGAGTGCCAACACCAGTAGTGACGTAAGAACTCCCGACACAACGCCGCCGAAGTCCATGAACGATAGGTACAATGCGTACGTCAAACCTTGAACGTC
CGAGTTTGAAGGGCAGTAGTACGTGGCTACTACTAGCAACTGCAACAGCGCGAACTCCGAGGTGAACGAGGTGATAAAAGACTCCACTGTGCCAAACGTA
CACACTGAGACGGGAAGCTGCACGACAGGTGGAGCTAGCAACAGTCGTGGCAGACCAGCAGCAACAGAGCACACTGTAGAGAGCAAAAAGACGCTTCGAA
CACTCCGGTTGGTGCACCACTTGGCGTACGACAGACACGACAGGAAGCGCCCGACCATGCCAGCGAGGTACATGTACTGCAAGCACTCGTGCTCGTCTTC
AAGGAGCGAGAACGTGTACTGGTACCATATCGTTCCATCGCCAGGCAGTGCATTGCACAAGAAGAAGAAGAGCATGGGCGGCAGCACCGGTCGCATGAGT
TCCCATTTGTGCTGAAGTTCGCGCTTAAACGGCAGCCACCACGAGTTCAGCAAACTTGTCGATGCAACAAATTCAACAGGTTCCGATTCTCTGTCGTCGT
GTAGCTCATCCACGGGTGTCTCCTTCAATCCAACGAGACACACTCCCGCCGCTGCTAGCGGCAGCATACTGGTCCATCCAATAACCTGCTGCGGCGTGAT
GCTCTTGTCTCGATACACTGGGATGCCCAGCACCAAGGCTGCAATCGACGCCACGTTCTTGACGCCATTGGCCAATGACTGCACGTGTGCACTGCTTCTA
CTGGAGGCATCTCCCGTCGTCAGGTCCACCAACAAGACGCCGAGCATAATCTGCGCGAAGGCTTCGGCCACGGCGTCTACGAGCTTCACAGCGAAAGCGC
CAGCGATCGAGTGCACGTACGTGGCCGTCAGCACCAATGAGACTGCGGTAACGACCTCGCACAGAACGATGTACGACTTGCGGTGGTACCCGAAAAGCGG
GAGGCTGTCGGACAGCAGGCCGTACAGCGGCTTGAGGTTCCAGGGGAAGAACGTGACCGAGTAGTAGAGCGTCGTGGTGGCTGGCGGCATGTGAATGACA
TCGAAGAGCCACATGCCGTACGCTGTCATGGGGAACGACATGATGAACGAGTGCAGGAAGTAGAGCGCCAGCAGCGCCACCGGCACTCGCGTCATGGCCT
CTCTTCCAGTCTCAGCATCTGATACGCATGGCTTCAAGCGGCACTGTAAACGACACAATAACAATCATGTTGTATCCAACAGTAATTTCTGGCGTTTGAT
TGGTGTGGACGAATAAACGTATTTGATTCGTTGAAATACAATGCCATGCAAACTGTTGTCATTGGCAGAAAACCATTACTGCCACGAGCACCAACGCACT
AGACTATCGCCTGGCGGAGGACGCTCGAAGATGGCGCGCGACGAGTTCAACATCGACGAGGCCGATGACTTCGACGACGGCACGCGAGCGGTGGTGCACG
CGGATGCGGCGTCGGATTCCGATGCAGAGGTGCAGGATGCAACGCGGCTGCGCTCGTCCCGCAAACAGCGACTGCAGGCAGAGCGCAAAGGAGGCAAGCA
GCGCGAGAAGGCGTCGGCTCTGCGCGTCAAGAACTGGGACGCGCTGGAGAGCGCCGAGTACGCGGGCAAAGTGGTGAAGCGCAAGGAACTAACGGAGGAT
GGACTGGAGTCACCAGACGAAGATGCAATGGCCGAGTGGTCCGATGCTGAGCCGTTCGGAGCGTCGGAAGATGAAGAAGAAGAGGTCGAAGAAGAGGAGG
TTGAAGAAGAAGAAGAAGAAGAGAGCGAAGGAGATGAAGAGGACAAGAGCGCGGAGATGCTCATCCGCGGCTTCCAGAAGGAGGATTCGGCACGGCTCAT
GAGCGCGCAGGACAGCGAGAAGGTCGTGGAGAAGGCGCAGCACGTGAGGAACCAGAAGATCATCTGGGAGCGCTGTTTGGAAGTACAGATCTACGCCAAG
CGTCTGCTGACAACGGCAAAGGATGTAACGGCACATGAGACGGACGGAGAGACGACGGATGAGGAAGCAGCTACGAAGACTAAGGAGGAGGTGGTTGCTC
AGCTGTACAAGAGCATCGACGCCGTGTCTGCACTGCAGGAGAAACTGTGCAATGTACCTGAGCTGAGTGCGGGTGACGCACCCACCAAGAAACGCAAGCG
CACGTGCGATGACTTATGGCAGGAGATCAATGCTAACAACCGCACGATCCTTCCTCAGTACAACGAGATTCTCAACACATACACGCGCAAGACCGACCTA
GCGGCAGGAGGCAAGAACAGCCAGGCGAAGAAGTTCAAGGCTGTGAACCAAGATATCCTTGCGCAAGTAGAGTCGGTGCTCGTGGATCCCCAGCGAGTCA
AGCGAAAGGCACATGCGCCGCTTGATGTACCAGAGGACGAGGCCACAGACGGAGCTCAAGACCTGCTGGATGAGCTCATGTACGACGACTCTGATTTTTA
CCAGCAGCTTCTGAAGGAGTTTATCGAGAGTGGTGGAGGTGGCGCTGGGCAGGACGCCATGGTGAGGCGCACTCACCGCAAGAAAAAGAAAATCGTGAAC
CGCAAGGCGAGCAAGGGCCGCCAATTGCGCTACACGGTGCACCCCAAGCTCGAGAACTTTATGTTCCCGGAGCCTTACCCCAAGCCGGAGATGGACGTGG
ACGAGCTTTTCCGCTCGCTCTTCGGCCAGGTTCGGCAGTAGAAAGCTTGACATTGACATGCTGGCCATCGAGAAATAGATTGATTTTGATCGGAATGTGG
GTGCTTGTAGGCGTGTTAGTGTTTCCTACGTACTTACCGCGGTAAATACCCTTCTGCCTACGCCATACGCCGGCGCGCTGCGTCTTGTTCAAGGAAGACA
TCGCATGTTTCCTTATAGCACATCGTCTTCTTCTTCCTCTTCCTTTTCGCCTGATAAGTACACTTCCTTGACCTTCGCTACGGTTGCCTCCAAATCCCGG
AGACGCAGTTCATTGACTCCGCTGGCGCCAATCTTCTTGACGATGCCCACCAACGTGGCTGCCTTCTCAGCGACGTGCACCACAGCCAATGCTCGGATCT
TCTTAGCTCGAGTAGCATTCTCCAACGACCGGAATTCCTCATCGGCTAAATCCATCGACGCATCAGCAAGCACTATTGTGGAGTCAAGGAGCGCAGTGCC
ATGCTCCTCAAAGCGCTCAGGGATGTTGAGCTCGTGCAGTTGCCGTACTTCCGAGGCATACGAGCCGCTCTTAAATACTTTGTGTTTGAGTTTCACTGTG
TCCTTCAGCAGCTGTGTGAACTTGTCGATCAGTTCTGGCTTACCCTTGGCGATTGCACGCATTGTTGCAGGAGCGTTTAGAATCTGTGCGCGCTTTGCGA
TCAACTGGCCAGCATCGCGTTCCAGGAACGAAAGCCCCCACAGACGTCCGTACGCCTTGCCAGCATCTAACCGCTCCTGTTCTGAGTAGTACCAGTCCCG
CGTTTCCTTGTTCTTGATGAGCAGACGCGATGACCAGGACTGGACGGAGTCAGTTCCGAGCGCAAGCCCATATTCCTCCAACTTCGGAGCGATTGCTTTG
TAGAAGGTGATCGCTACTTCGTCGGTGGACAGCTTCGTAGTCAGTAGTTCCGCAACCAAGCGGTTGACTTCCTCTCGATTGTCAACGAGCTTTTTGTTGC
TCTCCTTTCGCGCTTTCTTCTCGAGCTGCTCGATCATACTCATACCAACGGGTCCCTTTGATTGCTGGGATTCATCACCAAAGATGTCGTCGATAGCACT
TTCCGCGGCGGCCAGCTCCTGCGCCATCTGATCCTCTACTGACCGCGGTGGCATGCCATCTATTGTAGCACCACCGCTGCTCCCGCGACCACGCGCACCG
TTCGCCAAGCCACCACCATTTGACACTGTATTGATCCCGTGAACACACGCACACATCAGTATGCAAGCAAACGACAACAACGCACCTAACAGCCAACTTA
CCTTGTTGGATAATCTGCTGGTGTTGCATTAGAATACTGAAGAGCTGCTCCATTGAGACAGGGCCAGTTGGTGAGGCTGGCGCTTGAGCAGGCGGCTGAT
AATGCAAGCACGATTTAGAACTACGTAAACATTGACAAGACAAACAAGAAAGCTGTACCAAAGTAGGTCACTTACACCAGGGTCGTTGGGAGAAACGGCA
TCTGGACGGTCAAGTAGATCGGGATCCATCTCGTCCGCCTTCATTTTGAGCTTGATCTGCTCGTCAGGCATGCCCATTTGCCGCAGTTTGAAGTACTTCT
TGAGCTGTGGATCATCTTTTACAAGAAGTGGTTCGTACGGGACAACAGGCGCTGGAGCAGACATTGAGGGCCAGCTGAAGCCGCCACTAGATCCTTGGGG
TGGAGACAGCGGTGCCATTCCATTCGACGGATATCCTGACGAGATTTGCAACGGTGGCTGCAAGAACAGAAAACATAGCCAAAACGGTCAGATAACACAT
GCTTGATGCTTCACAACAGTGGACAAACTCACGCCAAGGTCGTTCGGTGACACTTGATTCGGGTTGTCCAGCAACTTGGGGTCCACGCCGTCGGCCTCCA
TTTTTATCTTGATCTGACCCATGGGCATGTCCATACTCTTCAACTTGAAGTACTTCTTGAATGCAGGATCGTCCGCCACGGTCATCGGGATGTAAGCACC
CTTCTCTGGCTGTAAAAATAATAAATAAACACCAGACCCTGCATAAGTCCTCGTGCCAACAAGACAACCTCGTTTTGTACGTACGCCCGGGTCGTTCGGC
GACACAGCGTCGGGTGTATCCAACAGTGACGGATTGACGCCGTCCGCCTCCATCTTCGTCTTGATCTGATCCACCGGCATGTCCATTCCCTTGAGCTTGA
AGTACTTGGCAAAGTCGGGGTCGTCCTTCACCAGCAGTGCAGTGTACACACTCCTCGCGCCTCCTGCGTACGTCTGCGTCTTCTTCTCCAGCTCGTTGAG
CTTTTCGTGCAGCGCCTTGATCTCCTTCAAGCTGGCGCCGGACGCTCCTCTCTCTCTGCTCACTGCTCCGTTCTTCTTGTCGGCCATGAGCTGGGAGATC
TGTCTCTGTAGCTTGTCAATGGACGAGCTGGTCGTCACGACGTCCGCTTTGGACGCCAGCTCCAGCAGCTTCTTGACCTGCTGGGGCGTGAGGCCAGGGA
CTCCCATGGTCGCGAGCGGAGCGTGGGCCACGTCTTCGCTCTCAGAGTCGCTCTCCTCCTCCTCCTCGTCCGACTCGTCCTCTTCCTCCTCATTGGCTGC
CTCCTTCTCCATGCGCCGCTTGATGCAGAGGTTGCGGTGCGCTCTCGCATGTCTTCTCTTGCATGTCTAGTCATATTCCACATAGTCATATTCCATCCTC
AGTTAGTGATAATCCACCGTTTCTTAGTCGGAATATATGCTGACGTACTTCGCTGCAGTAGGACGCTTCGTTGCAGATGGTGCAGGGTAGCGACGCGTTG
GGCGTCGCACAGTAGGCGCAGTCCTCGCCCGCCGACACCGCGAAGCCGCCTGCCAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATGGCGA
GTGATTGACGCGAGGCTTCTTGAGGACTGCTGCTTTTAGAAACACCAGAAACGGGTCTGATGGGTTTGATGTCTCGGGACCCGAAACTTTGGCTGATTGT
CCACAAGTAGAACGTGCCTCGGCCATCCTCTCATCAACAGGAATCCAGTTGATCCAGTCTTCTGGATAGCCGCAGATGGAGTGAAGCCTACCAGAATCAG
ATCGATTGGAATTCGTCACTTCAACTTGCCTTTTGCCAAATCTTGTGAAAAGAGTGTCATGTGTATTGCTCTGCTACAATATGAATAAATAGTGCGGCGT
GCGGCCATGCCACTACGCTCTTCGACCGAGCGTAGTTGGCCGCGTGCGGCTTATATAGATAGGGTTTGCCTTGAAAGGAGAGCTGCGTGTCGTCCTCCTC
TAGGCTGCAGCTCGGGACAGGCGACGCTGCGAGAGCATGCGCACCATGTCCGAAGACTTGTCGGTCTCGCTAATGTTGAGCACGTAGTCTGATCCCACTT
GCTCGTTGGTGACAAAGCCCGAGAACCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCCGCGATCATCATGGCGTCGCTGTCGTTCTTGGT
GCGCTTCTCGGGGTCGGCGTCGTGGCGCAGCAGAAACTCGGAGATCGCCAACGAGCCCAGTTTGGCCGCAAAGTGCAGCGGGGTGATGCCACTCGCTGTC
ATGACATTCACGTTCGCGCCGTGCTCGACGAGCAGCGAGACGATCTCGATGTTCTGCGAGACAATGGCGGCATGAAGAGGGTAAGTGCCGCGCTTGCTGC
AAGCGGATACCTTGGCACCAGCCTCCAGTAGCAGCTTCACGACGTCGACGCATCCGTTGCGGCACGCTGCGATGAGCGGGGTCACACCAGCATCGTTCGC
CTTGTTGACGTCTGCGCCCTCGTCCAGCAACAGAGACACAACGTCTGTGCGTCCCATGCGGGCCGCGATGTGCAGACACGAAGACCCATCGGCCATGGCC
GTGTTGGCGTCGGCGTAATTGAACAAGATGAGCTGCACGGCGTACAAGTGGCCGATACGGCACGCCACATACAGACAAAGCTCCCAGCGGCGAGCCTGGG
TGAGCTCGGGTGAGCGCAACTCCTCGATGTCGTTGGCGAACTGGTTCAGTACGTGCTCGCAGAACTCCTCCATGAACGAGTGCATGGTGTGGACGCGCAC
GGCCTTCACTTGCAGGGACGGGAGCGTCATGCGGTCAGGTTCTACGTCGTTCTCTTCACTTGACGTAGGCGTCGAGTCCTCTTCCATTCGAGGCTCGACA
GCGCGTGGAGCACCAAGATGCACCTCACTTAGCTCAGGAACGCCTTCCTCTTCTTCATCTTGGCTAAGCATCTGCTCGGCGCATTGCTGCCTCCACCCGT
TCAAGGCGAGCGGGCGGTGCAGCGCCGCCGAGGCGTCGGTGGGGAAGTGCTCATTGGCGCCCAGGAAGTTGGCATACGTCTTGAGCACGAAACAGCTGCC
GTCCTGCAGCTTGTCCCGCAATGTGGCACTGGTGAAGGTGCCAAAGAAGTCGTGTAAAAGCGTCACGAAGGCCGCGAACGCATCACGGCGCTCATTAACG
ACGGCATGGTCGAGTCCCGAGAGCTTGGAGCGCAGTGAGCAGCGCGACGGGAACGGGAACGACCGCAGCAGCGGGTACAGGCCGTCAAACTCGCAGTGGT
CCTTGGCGCAATGGCATTTGTGCGCGAGGCTGAGCGTCAGGTGGTGGCGGTGCTTCGGCTCGTTCACACGCTCCCGCAGCGTCTTCCACAGACGGCGGAA
CTGTGAGTACGAGCGTAGCGTGGTGCACACGCCGTTGGCATCTCGCTTGGTGAGCTTGAGTGCGAAGAAGACTTTGCCGTCCGTGACCTGGTAGGAGGGC
ACGGCCACGTCGTACTTGTGGACCCAGCTCATGTGTTTGTCGAAGGTGGTGTCTTGGCGAGTGGCTGCGACGGAATTGGCGACAGGGTTGCTGGCTTCTA
AAGGTGTTCGGATGGTTCTCGGTGCGCCGGTCTTTCGAGATACGACCGAGCTAGTAATAGCGAGGGCCGGAAATAGAGTCCCGAGGGGATTCGCTGGGTT
GGTACGAGCTCGCTGCAAGCAGCAGAGCTACGTGGATCCTTTTCCGCGTTGGAAAAATGGGAATTGGTCCAGTGCCGGACAAGCGCCAAGATGCGGCGTG
AACTCGACAAGCATCGTCGTTGATGAAAGTCACACGCGGTCTGATCTACCAATGGGCGCGCGTCAAATCCCCTATTTTGGCCAATGGCCATGCGGTCCCC
CCTTTCACAACCGAACGCAGAAAATACGCGTGTTTCTGCCCCGGCATTAGCTTGGCTGGCATTCATCCACGCTTGACGATTTGCACCGTCGGCGCGGTCT
CCGATGTTACTGCGCGTCACCAACACTGGTGCGAGCTGACCAGGCCGCCGCAGTCTGCATGGAACGACGTGTGCAATGCAGAACACAATTCCCACTGCAA
TCTTCCGTGTCACTTCCCATTGCTGCACGCAGCCCACAGCCCTGGGGAACGTACACCGTGAAGTTTGGGGACGTTACCAATTCGGGGGAGCACAGCTAAG
AATTGTCAAATGCTCGTTGCGATCGCGACAGCCGATGGATTTTCGCAGCGTCCCCAGCTCGTGGGCTTTGTGCACGTGGGGTCAGCAGGGTTGAGCCCCC
ACTGGTCAGCAAAGTTGAAGCGAGCAGCATCAGCGAGATCCGTCCGGTGCACCATGCAGAGCTCCGAGGCCGTGAACTGGGCCTGCAGTAGTTGCAGTGC
CTCAACATCCAAGGCAGTGCTGGTGATGCGAGCCCCCCGGGTGATCGCAATTGTAGCCCCACCGCTAACGACATTCAATTCCTTAGCGGTGGATTTTCAT
GAGCACCATCCGAGCGTTCGATCGTCCGTGCGACTTGTAAAAAATTCGTATTGCCGCAGACGAACGGCAGTGTCGTGTTTGTGCTTGCAGAGGATTCCGA
CACAACGTAAAGGCAGGCTTTGCACGGACACTTGGTCGACGTACATGTACAAGCGACTCCACCTACAGGGTATCCTTGAAGCGGAGGTGTTAGCCAATGC
AGTGATGCTGTAGAGTTACAATCAAAACGGCGGACCAAAAGAGCGGTTTACAATCAAAGTCGCTCGAATGACCTTCTCCATGTAGCTCTTGTGTTTCACC
AGGAAATGAGAGAGGGGCGAATCCTAGCTTTGGCGCACAATCGGTATTGAACTTCACCTTCAATTCGGAGAACTCTTGTCATAGCTCCAGTTGAAGTTCG
CAGCAGTTGGCAACTTGAGCTGCTTCAAGCTTTCGCTGCCTTCAAGAAGTCTTGCCATAAGTTGCTCGCTCGGCTTAACTGCTTCCTGTATTGTGGCTTC
TGCTCCATCGTGCTGGTGACTTCGAGCTCACAAGTGCCAAGCTACTGGTCGCGTCTCTTCAAACATTCGAGATCCCTCATGGGAAGATTGGTAGCTGCGG
TATGCTGCGCCATTGCTACGACTGCCGTGATCCACACAACCGAGGCGCTCGCTTGCAATGCTGGCACGTATTTTGACGGCACCAAGTGTTCGCGATGCCC
CGGAGGCACCTTCGGCTCCACACCAGGACTCACTTCATCGTCGTGCTCCGGACAGTGTACGGGTGGGTTCGTTTGCCCCGAGGGGTCGACCTCACCACGA
GAAAAGCCTTGCGGCACCTCCACCTACTACTGCCCCGCAGGGAGTGGGGAGCGTCGGAGGGTAGACACGGGATACTACACAATCACGTTTCCAACCGATC
AATACAGCTCGAAAAGTGGTGCAGGACAGCAAATACGCTGCGAGAAGGGATACTACTGCGTCTTCGGGATCCGCCGAGCCTGTCCTGCTGGGGTGTTTGG
TGAATCCACGAGACTCACAACCCCAGCATGCTCTGCTCCGTGTCTGATGGGGTCGTACTGCCCCGAGGCAACATCCGTGCCGATCCCATGTCCCGCTGGA
ACCTATGGGGGTGAACTTGGTCTAACCAATGCTCGATGCAGCGGACTCTGCCCAATCGGGCACTACTGGTACGTTTTTCAACTTGCAGCGTGTTGATACA
CTGATATTTACTGATTACTTTGCTTGGAACAGTGAGAAGGGGACAATCGTTCCGGTCGCTTGCCCTATTGGGATCTATGGAGCTACACAGGGTCTCATGA
CTCAAGCATGCTCGAGTACATGTTCTCCAGTCAATGGTGTGCTTTCGTGCCTTCCTTCACCATGCCCACCAGGGTTTTACTGCCCGCTTGCGGCAACAGT
GCCCTTGGAATGTGGAGCAGTGAGTCAGTTTTGCCCCAAAGGCTCTCCACTGCCAACCACTGCAACTCCAGGATACTACACGACCTGGAAGGCGTACTGG
GGGACGACCGCGACAGGAGAGCAACTAGCCCTGCAGTATGTTGAAGGCAGCCAACTTGCCGTTCGGAACCAAACCACTCGATCAGATCAGCACATTTGCG
AAAAGGGGTCATTCTGCATTGGTGGCGTCAAAAGGCTTTGTCCTGCTGGAACTTACGGTGACAGCGAAGGTTTGCCGACTGCAACTTGCACCGCGCCATG
CCCTGCTGGCTACTTTTGGTAGGGACGTCAACGTCCCCGCATTCTTTCATATCGTCGTGGTCTAACGGATCTTCCCGTGTTTACTTTCAGTCCGGTAGGA
ACGGCAAACTACAAACTGCAGCCGTGTACGTCGCGGGCATCATTTTGCCGCCAAGGCTCGTCAGTTCCCATTGCTGTCGCCACTGGGTACTTCACAGTCG
CAACACAAGCAGGGCTTCGACCAGACGAAACAAAATGCCCAGCTGGAAGCTATTGCACCGCTGGTGTTCAATATCTGTGTCCTGAAGGCACTTACGGAGC
CACGCCCGGTCTCGCGACCAAGACGTGCACGGGCAAATGCCAGGATGGATACGTCTGTCCACGTGGGTCAACGTCAGCGATGCAATCACCTTGCCCGGCA
GGATCGTACTCGCGAAATGGCAAAGTCTGTGCAGCCTGCTCTCCTGGGTACTGGTGCGGTGTTGCATCTCCGGACCCCCAGCAACACGCCTGTGGAGCTG
ACAATACGTTCTGTCCTCTGGGGTCGCCAGCTGCCCAACTGGTGCTTGATGGCTATTACGCTGTGGGACAGCAACTTAGTACACACGCGTCGGAGGCGTT
GTGTGTACTTCGCGATGCCCCCCATCTTCCACAGTGTCCTACAAGAACTATAGGAGTGAACGGTAACCTTTAAC