Description :
From Genome Similarity Track
Location :
contig_41:231847- 234888
Transcript NameFunction/comments
g8903.t1hypothetical protein

Sequence
3041 bases(100 bases per row)
CGAACTTGTTCTACTACCTTTTGGGGAGCAGGTCTAAGGATACGAGCTGTTTCGTTGCGAGAAATCTGGCACATCGTTTCAGGCATTCTCCCTGAAGCAT
TTGAATCGACGAGCTGAAACTCCAGGATATCAAGTTCTTCCACCTCATCTACTACCAAGGATCCAGACTTCAGCTCTGTGTAGCCAAAATGATGGTGACT
CAGTAAGTGAGAAAGACACATACGAAAGCAGAAATACCTTTTTGCATTGTGCACTGTACCTGATTCCTGGCGAACGAGCTTCAGCTTTCCTTGTCCAAGC
TTGGAGAGAGAAACTTTTGAGCGCCATACCAAACTCGCTTCATTAGCCGGGTCGGCGTCACCGTTGTTATCGTCAAAAGGATTGGTACCGCTGCCTCCAT
TTCTCTCGATTCCGTTGCTTGTCTGAAAATTGCAGTGCTTTTTCAGACTACTCATTAGATCTGCTACACTCATCGTCGCCGCACACTCCACTCGAACCAG
TTCGTCCGTCGGAAGAACCACCCTGATACAAAGCCACAGAGGTTCGTGTTAATCCAGCGTAGTCCAAGCACACAGCCCTCTCCTCTTGGTAGTCCCCACC
TCACACACGTAGTCGCCTTCATCCTTCCACCGTGTTATTCGCACCTCCAAATCTTGCTCAGGGCGCTGCGTATTCCGTTTCATCGACCAAAAGCCGCTAC
CGCCGAGCGTCTCGGTTAATGTCGCGAAGAGGCACAGCCACCCGAACGGCTAAACAAAGCATGTTCTTATTGGATTTCTTGCTAGTGAGGCATGTAGGCA
TTGCCGAAGATGTCGGGGCTATCTCGGACGAGGTCCCATACCCACGGTTCGTCCTGTTTTGGATTGTAGGTGGTCAATGGGAATCCGTACGGCAGCGGCA
GTAGCTCTTTTGGCTGTTTTTCTGAGCTCTCAAAGTCTTCCACGCCGGAATGCCCAGCCGCTGCTTTACTTCCAATCGTCACAAGATGCGGTGAAGTTCC
ACCATTTTGATGCGCCAAAAGCGGTGGCAGGAACATGACACCGAGTTCATAGGACCGGACCATGAACTGCGTCTTCTTTTTCTGAAGCGTCCCCCAGGCA
GCCTTGCTCAAGTTGGAGCTGGTCACAATAGCCCAGTCCAGCGCACCCGCTGCCTCATCGCTCGGGTCAAAGCGAGCGTATGACTTGATGTGCGGCATTG
CGTTTTGTCGATGAAGCACTGACGGAGGTGTCCACTTGCGGAGGTATTTGTGCAAGAAAGGCTTCATGTTCTTGAGTGGGCAGGGAATCGACCGCCCAGA
GTTCCATCCTTCGAGTGAGTTCCGCTAAGTCAATCAACCAACAAGGGTTAGTAGCCTATTACAACAAACTGCAGCTTTGCTGAGCCAGTAAATGCCATGT
TGATCAGACAGGTAAACTTACTACATCCTCGACCGATGGCCAAATAATATGCAATGCTTGAACTGGCATGGATGATGCTGAGATGTTCTTCTTCCCCGGC
AAGAAGCTCTCGGCAAACTCACCGAAGAGCCACTTCTCGTCGAGAGACCCGAGGCTTGAAAACTGATAGACCATTCCAACTACAGTGAAAAGGACGCACA
CGATAGAAAGCGACTTGAATTTCGATGAACGTACCTGGCAGATCAACGGGTTGTCCGTCTGTGGTACATTGAATGTCTTAAAAGCCTGTTCAACAAGAAG
CAATACGCAACTGGGAAATGAACGAAATGCGCACTCCGAAACAATACAGTACAGAACTCACTTTCGCACTCGAAGATGCCCATATCTCTCCATATCTGCC
AAACCAGCACAAGTCTAAGCATCATAATTGCTTCCGACAATAATTTCTTTCTTACCTTTGCCTTTGTGAACCCCGGGGACGGAAGGGATCAGTGCAACAT
GCGCACGTGAAAAGTCAAAGCGCTTGAGCTCTCCGCAGAACAACTTAGCTTGTGCTCCGAGTGACGACAGATAATGAACAAGGTCCTCCTCAAAATCATT
TCCACCACGAGAGCTCGCCGTGACCGCTTCCTTTTCCTCTTCCTCCTCACTGTCATCCAGAATTTTAAGACTAAAGTCCTGGAACCAAACACCTTGCGTC
TTGGTGTTCCAGTCACCCGACAAGAAATTGGCCGTAAAAATCGCCACCCGCACTTTGTCCGGGTACAGCGCGACCAGCATCTTCGTGTGGTGTGTGCCGA
ATGGAATCGGCAGCGGTGGTGCCACCGGCGTCACGTTTGCATACTCTCGGCACTTCTTCGTCATCCTACACACACAGACACACATTAACACAAAATCAAA
ATATACTGGAAAGCAGTCTGGAGCTGCTGCGTACCCCTGTCGATCCCTCTCGCCATGTACCAACAACACCGGCACTTGTCTCAGCCTCGGACACTCGGAG
AACAGCCACGGGAGGTCGTACATGTAGTTGGTGAGTAAGCAGCGAGTGAATTCTCCCTCCAGCAGGTCATGTAAGCTCTTGCAGTGCACTACATGGGCAA
ACATACGTAAATACATGCAAAATGACCGACAAATGGGGCTTTTAACGCACAATTGTGCGCTGCCGGAGCGTTTTTCAGCCGCGTCAAGTAGAATCTGCAT
TCTCGTGCATCTGTAGCTGCTCGTGGTGTAGCAGCTGATTGCTTTACGGCGGCAGGAGCGTCAGCCTCGCGCTTCTGCCGCTTGGGCGCGGGTACAGCGT
CCGCCATCGACTTCAACTGTCAGTATTATAATAACTGGCGGTTATTTATTCAGTAAACTATATTTTCGACGAATCGGAAGTGCTGAGAGGTTCATTTTGC
AATCATGCAGTCGGGAGGAGCAGGAGGCGACGTCGACCGCGCGTTGAGCAGCATCCGCGCGCGCGCCGACCACCTGCGCCACACGGTCGCGCGCTTGGAG
CACAACTTGGCTTGGAATCCGGCCAGCACCTGGTAAAGCGCGCGTTTTGTAGCGATGTATAGCGCTGGGGAATTGACGGATTTGGTGGTATTTTTTTTTT
AATATTACGCAGGCCGGAGCTGCTAAGCCAGTACATGGTCA