Description :
From Genome Similarity Track
Location :
contig_41:231811- 234822
Transcript NameFunction/comments
g8508.t1hypothetical protein

Sequence
3011 bases(100 bases per row)
ACTCTGTTTCTCTAGTGAGGTTTTGACGTGCTGATCGTTCCTCTTGAGGCTTACAATCCTGGTTTTCCTGCCACAGTGGACTTATTGTGGAGAGTGGCGA
ACTTGTTCTACTACCTTTTGGGGAGCAGGTCTAAGGATACGAGCTGTTTCGTTGCGAGAAATCTGGCACATCGTTTCAGGCATTCTCCCTGAAGCATTTG
AATCGACGAGCTGAAACTCCAGGATATCAAGTTCTTCCACCTCATCTACTACCAAGGATCCAGACTTCAGCTCTGTGTAGCCAAAATGATGGTGACTCAG
TAAGTGAGAAAGACACATACGAAAGCAGAAATACCTTTTTGCATTGTGCACTGTACCTGATTCCTGGCGAACGAGCTTCAGCTTTCCTTGTCCAAGCTTG
GAGAGAGAAACTTTTGAGCGCCATACCAAACTCGCTTCATTAGCCGGGTCGGCGTCACCGTTGTTATCGTCAAAAGGATTGGTACCGCTGCCTCCATTTC
TCTCGATTCCGTTGCTTGTCTGAAAATTGCAGTGCTTTTTCAGACTACTCATTAGATCTGCTACACTCATCGTCGCCGCACACTCCACTCGAACCAGTTC
GTCCGTCGGAAGAACCACCCTGATACAAAGCCACAGAGGTTCGTGTTAATCCAGCGTAGTCCAAGCACACAGCCCTCTCCTCTTGGTAGTCCCCACCTCA
CACACGTAGTCGCCTTCATCCTTCCACCGTGTTATTCGCACCTCCAAATCTTGCTCAGGGCGCTGCGTATTCCGTTTCATCGACCAAAAGCCGCTACCGC
CGAGCGTCTCGGTTAATGTCGCGAAGAGGCACAGCCACCCGAACGGCTAAACAATGCATGTTCTTATTGGATTTCTTGCTAGTGAGGCATGTAGGCATTG
CCGAAGATGTCGGGGCTATCTCGGACGAGGTCCCATACCCACGGTTCGTCCTGTTTTGGATTGTAGGTGGTCAATGGGAATCCGTACGGCAGCGGCAGTA
GCTCTTTTGGCTGTTTTTCTGAGCTCTCAAAGTCTTCCACGCCGGAATGCCCAGCCGCTGCTTTACTTCCAATCGTCACAAGATGCGGTGAAGTTCCACC
ATTTTGATGCGCCAAAAGCGGTGGCAGGAACATGACACCGAGTTCATAGGACCGGACCATGAACTGCGTCTTCTTTTTCTGAAGCGTCCCCCAGGCAGCC
TTGCTCAAGTTGGAGCTGGTCACAATAGCCCAGTCCAGCGCGCCCGCTGCCTCATCGCTCGGGTCAAAGCGAGCGTATGACTTGATGTGCGGCATTGCGT
TTTGTCGATGAAGCACTGACGGAGGTGTCCACTTGCGGAGGTATTTGTGCAAGAAAGGCTTCATGTTCTTGAGTGGGCAGGGAATCGACCGCCCAGAGTT
CCATCCTTCGAGTGAGTTCCGCTAAGTCAATCAACCAACAAGGGTTAGTAGCCTATTACAACAAACTGCAGCTTTGCTGAGCCAGTAAATGCCATGTTGA
TCAGACAGGTAAACTTACTACATCCTCGACCGATGGCCAAATAATATGCAATGCTTGAACTGGCATGGATGATGCTGAGATGTTCTTCTTCCCCGGCAAG
AAGCTCTCGGCAAACTCACCGAAGAGCCACTTCTCGTCGAGAGACCCGAGGCTTGAAAACTGATAGACCATTCCAACTACAGTGAAAAGGACGCACACGA
TAGAAAGCGACTTGAATTTCGATGAACGTACCTGGCAGATCAACGGGTTGTCCGTCTGTGGTACATTGAATGTCTTAAAAGCCTGTTCAACAAGAAGCAA
TACGCAACTGGGAAATGAACGAAATGCGCACTCCGAAACAATACAGTACAGAACTCACTTTCGCACTCGAAGATGCCCATATCTCTCCATATCTGCCAAA
CCAGCACAAGTCTAAGCATCATAATTGCTTCCGACAATAATTTCTTTCTTACCTTTGCCTTTGTGAACCCCGGGGACGGAAGGGATCAGTGCAACACGCG
CACGTGAAAAGTCAAAGCGCTTGAGCTCTCCGCAGAACAACTTAACTTGTGCTCCGAGTGACGACAGATAATGAACAAGGTCCTCCTCAAAATCATTTCC
ACCACGAGAGCTCGCCGTGACCGCTTCCTTTTCCTCTTCCTCCTCACTGTCATCCAGAATTTTAAGACTAAAGTCCTGGAACCAAACACCTTGCGTCTTG
GTGTTCCAGTCACCCGACAAGAAATTGGCCGTAAAAATCGCCACCCGCACTTTGTCCGGGTACAGCGCGACCAGCATCTTCGTGTGGTGTGTGCCGAATG
GAATCGGCAGCGGTGGTGCCACCGGCGTCACGTTTGCATACTCTCGGCACTTCTTCGTCATCCTACACACACAGACACACATTAACACAAAATCAAAATA
TACTGGAAAGCAGTCTGGAGCTGCTGCGTACCCCTGTCGATCCCTCTCGCCATGTACCAACAACACCGGCACTTGTCTCAGCCTCGGACACTCGGAGAAC
AGCCACGGGAGGTCGTACATGTAGTTGGTGAGTAAGCAGCGAGTGAATTCTCCCTCCAGCAGGTCATGTAAGCTCTTGCAGTGCACTACATGGGCAAACA
TACGTAAATACATGCAAAATGACCGACAAATGGGGCTTTTAACGCACAATTGTGCGCTGCCGGAGCGTTTTTCAGCCGCGTCAAGTAGAATCTGCATTCT
CGTGCATCTGTAGCTGCTCGTGGTGTAGCAGCTGATTGCTTTACGGCGGCAGGAGCGTCAGCCTCGCGCTTCTGCCGCTTGGGCGCGGGTACAGCGTCCG
CCATCGACTTCAACTGTCAGTATTATAATAACTGGCGGTTATTTATTCAGTAAACTATATTTTCGACGAATCGGAAGTGCTGAGAGGTTCATTTTGCAAT
CATGCAGTCGGGAGGAGCAGGAGGCGACGTCGACCGCGCGTTGAGCAGCATCCGCGCGCGCGCCGACCACCTGCGCCACACGGTCGCGCGCTTGGAGCAC
AACTTGGCTTG