Description :
From Genome Similarity Track
Location :
Scaffold_6:2318083- 2343848
Transcript NameFunction/comments
Phyin_T30-4PITG_04717Putative uncharacterized protein
Phyin_T30-4PITG_04718Protein pelota
Phyin_T30-4PITG_04719Trafficking protein particle complex subunit 2-like protein
Phyin_T30-4PITG_04720Putative uncharacterized protein
Phyin_T30-4PITG_04721Dynein light chain/pantothenate kinase
Phyin_T30-4PITG_04722Notchless family protein
Phyin_T30-4PITG_04723Putative uncharacterized protein
Phyin_T30-4PITG_04724Serine protease family S10%2C putative
Phyin_T30-4PITG_04725Putative uncharacterized protein

Sequence
25765 bases(100 bases per row)
CCACTACACGTTCTCAATATGCTTGAAGCTCGCGGCGTTGCTTTCAAGATCTGCGCTCAGGCCCGCGGCTTCTGCGATTCCGTTAGCGCTAGGACCCGCT
CGAAACCAATCTAGGGCACAATCTTTGTTCTTCTGGAAGCACAAGAATGCCTCCACCATCGCCGGATTTTCTGCCAGTGCTGCCTCACGCGTAAGGCCTT
CTGTGCGCAGCAGCACATTATGCACATTGCTTCGGACAGTCTCGCCGCTAGAGGACGCAGCCGGAAGCGACAACACCATTTCAGCATACGGCGCAATAAG
CGGGAAGCGCAACTGGTTCGTTTTCCACCACGCCAACGGGTCAACGTTGCGTTCCGATACTGGGAGACTCAAAAAAGCGCTCAGCTCCTTTTCCCACGTC
GCGACCATCTCACTATTCCCCTGGAGAGACGACTTGGATGATTCCGACGGCAGGTGAGAGAGCAGATCGTCATCTTCGTCTTCGCCGAGGGCCACAGTGT
TGTCAGTAGGGCTGGATGGATCCTTCCCCAGCTCTGGCAACGTAGAGGCCGATAATCCAGTAGAATTGGAGGCAGTTTGCCCTTCAGACGTGAACATTTG
ACGCAGGAAATTTTTGCCAATATCGCAGTCGGTTTTGAACGACAGATAGCAGTATTCACGGTTCTTATAGCGCGGGTCGAACAGCGTCGCTGCGTAGCAT
ACAGGTGGCAAGCATGCAAACTGATCACGCAGTTTCCTCGCCAGCGTCTCGAAAAAGTGTTTCCACATGAACGGTTCCAAGTGGGAGGGGACAGTCTCAG
CTGCTGTCTGCGCTTGTTTCTCAGCATACGTCACTAATGCCGCAGCGATCGTAGAAATACTGGAAATGCCGTTCTTGTTCACTTCCTTGTCGCTGCCAGT
TTTCTTGTTCTTTTCTCCTTCCAGCGCCTCCGAGTATCGAGCAAATGGTCGTAGTTTCTTCACTAGCAGCCCCAAAAACTCCACAGTAGTCGCAGACATG
TACTCAATCAGATTCGCACTGGCGATCTGCTCCAGTGTGGGCAGTTGGTCCACGAATTCCCGAAGAAAATCATAGTACGACATTGACTCGAGTAGAGAAA
CCTCCAAGTTGAGCAGCGGACACACCTGGCTAAAGGCAAGGATGGCAGTCTCACAGTCTGCGAATCGAGTCACGAAATCGTCAACTTGATTTACCACGTT
TGGGAACGCTTTGGTAAAGAAACTCGGAGTCAAGCATACACGCAGATGCTGCACCGCGGACGTCAGGAGGAGCGTGTTTTGCGCTGCACCAGGTGACGCA
ATTCGACCATCGAAGTTAACTGGGACGAAGAGCGACGGGAGATCGGCCGCTGTGAGCTGGACCTTCGCAGGTAGTTCATCCTTGATACAGGCAATTACTT
TATCCTTGATACCCAGTCGTTCCAGGTACGAGTCGACGATGGCCTTAATCGTTTCCACCCCAGCTGATTCGTCCAATGCTGCGACGCCTACTGCAATGTC
AAAGAGTTTAAAGTTCACACTAAAGTGAATTTTTACAGCCAGATACTGCGTCGGCTTGGGTTTCGTAGAAGAGGGGTGTTGCCAGAGCTCCAGCGACACA
GCAACGCTCTTAGCTCTCGCTAGTACCATCTTGGTGGTCAGGAACACGCTTTCTTGCAGCAAGAGAATACTTTTCCCTATGGCTTCTGCACTGGGCAACG
GCAGCTTCTTGTCCCCGAGCAACTGACTCACTACGTACTGCATTCCTGGCTTTGTAGCGAAGTTCAGTGGCAAATTATCCATCAGAGCCATTAAGGCCAA
GTCTTGTGTGAACTGCTCCGTATTGACCTGGGCAGGCTGCACTCCATACCCTGGGCCCAAAGCCTCACGCTGTTCCCTGGTCATTGCCAGCCCCGCAACG
TTTAGTGCTGGTGTGTAGAAAGCAGCCGGATTATCTCTTTTAAGAGCGGCGGTGAAGATACCAGGAGATCCTCCAGCCGCGGCCACAGCGGCGGCCAGCG
CTTGAGAAGCTGCCGGCTGAGGATACATGGCTGCAGTGACGAATTCTGCGCCTTGGCCTGCGATGGCCTGTATCCCCAGCTTCTGGCGCTTGACATGGCG
CTTCGTCTCTCGGTGTTCCTCGCAGACGTTGTTCGCCTGTTGGTGCACCGTGTCCGTGCGACCGGCTGTGCGCAGATGCGAGAGCAGGTTGGACGAGTGG
TGGCCCTTGATCACACGCTGGCAAAACTTGCAGATGGAATTGCCCGACTGGTCCTTCTCAAAATACGACCACACGGCCGAGACGCTGGCCGGTCCATTGG
CCAGCGGAGGAGCATGGCCTGCGGGCGTCGACGGCGCCGACGAAGTGGTAAGCGCAGCGGATGAAGCTTGCAGGAATTCCGCACTGGCAGCCGGCACTCG
CTTGACCATCTTAATAAACCGGTACAGCACGGTAAAGTCGAAATGCCTGGTGAGAATGCTGGGGCTTTTCAATACAAAATTAGATGTCGCCCTTGACATG
TCATCTCTCCTGTCAATAGATACACGTAGTAATCATTTGAGTATGCTAATATAAAGAAATGTAAAGATACCAGATGATGAGCTTGAATTGACCATTGCTT
CATGCATCCTCCTTGTCTCCGCACTAAAGGTCGATAGGATTGAAGAATGTTGCGTCACATTTGCCACCGCCGCATCGGATTGATCGGGTGTCGAAGCTTT
TCTGGTTGGTATCAGATTATGCATGTACTAGGGTCGTCCACTTTGAGTTCTTACGTGTTCATGCTTAGTCTCTAGCAATGCCGTCGGCTTCATTGGTCTG
GGCAATATGGGCTTTCCAATGGCGCACAACTTGCTGAAGGCAGGAGTGGACGTGCTGTGTTTTGATGCCAACCGCGCCAACGTTGATCGCCTCGTGCTAC
TCGGTGCGAAACCTGCTGCTTCTGTCGAGGAGGTAGCAGCCCAAACAAGTACGATCTTCTCGGTGCTACCTAGGGACGAAATCGTCACAAGCGTCGTTAT
CGGAAATGAAACAAAGCATGGATCGGGTTTGCTGGCCAGCATGGCACCTGGCGCGTTACATGTCGGCTGCTCTACGATCCACCCGAACACGTCACGTACT
CTTGATATCAAGCACCTTGAGGCGAAGACGAAATATGTTGCAGCTCCTATTTTTGCACGTCCTGACGGCATGGAAGCCATGCAAGCGAACTTCGTCGTGT
CAGGCTCCGATGCCAGCGCTGTGGAGCAGGCGTCTCAATGGCTACATAAGTGCACGAATGGACGAGTGGCGTCGTTCAGCTCAGAGGATCCTGGCGCGGC
GAACGCAGTGAAGCTAAGCGGCAACTTCCTCATTGCTTCAGCTATCGAGTCAATGGCCGAGGCATTGACACTACTGGAAGCGAACGGCGTGGATCGTGTG
CAGGCCATGGAGTTCTACAGCAGCACGTTCTTAAAGTCAGTTATCCATAAAGGATATGGCCAGCGCGTGTCCGAGCGTGACCACCGTCCCGGTGGGTTTG
CACTGGAGCTGGGCTATAAGGACCAACGTCTGACTCATCAATTGGCGATGGAGTCACAAGTGCCAATGCCATTCCTGTCCACACTCATCGATCGCTTCTT
GAGTGAGCGAGCAAAGGGCCGCAGCGATCTTGACTGGTCCGCTATTGGTCTCGGTGTGTGTGAATCCCGTGGTGTAGACGTCTCGGAAGCCATTGACCGC
TCTCGTGCGGGGCAAGCGCCAACACCACGCACAATGTAGCTTGGCCATCTTGTTGAAGGTTAATAATACCGGTATTATTGTTTTGCTGGATAAAATAAAG
CCACCTTCAAGCAACATTCTTGTAATTTTGCCATCGCAGGCAAAGATGAAGCTGCTCAAGAAGCAGATCAACGAGAAGGATGGCGCCGGCTCAGTGGTGC
TGCGTGCGGAGGAGCCAGAGGATATGTGGCACATCTACAACCTCATTCATGTCTCCGACTCTGTCAAGACCACAACGATCCGTAAGGTACGCAAGGGCGG
CGTATTGATGCAATGATCAGTCGTACTTAAGTGAAATATCGGACGCATGCAGGTGGTGAAAGAAGGTGTTACAGGCTCCACTAGTAGCCAACGTGTGCGA
ATGACGCTGCACATTGAGGTGTGGTGCTAATGTGCTGAGATATGATCGTTCAAGTGATAAATATTGGATTTTGTGCAGGTTGAGCAAGTCAACTTCGATC
CAGCTCTGTGTGTGTTGCGTATCAAGGGCAAGAACATCATGGAGAGTCAACACGTTCGGGTACGTTTGTAGTGCTATCAGAAAGGAATGAAATAATCCCT
CCAACGACGTCGTGTGCCTGTAGTTGGGAGCTTACCACACACTTGATCTTGAGATGAACCGGGACTTCACTTTGACCAAAAATTGCTGGGACGTCATGTC
GCTTGAACGTATTGAGATGGCGTGCGACATCACCAAGCAAGCTGAGCTAGCGGCAGTGGTTATGCAGGTTGGCTTAGCACACTTGTGCTTGATAAAGGGC
GACATGACTGTCATCCGTGCCAAGATCGAGACGAGTGTGCCCAAGAAGCGTCCTGGAAACTCTGCCCACGCCAAGGGCACCGAGAAGTTCTATGAGAACA
TCGTGCGTTCCATCCGACAGCACATTGACTTCAAGCTCGTCAAGTGCGTCCTGCTAGCGAGTCCAGGATTTGTCAAGGACGACTTCTTTAAGTTCATGAT
CGAGCAGGCTGTTCGCCAGGACGACAAGCTCATTCTCGAGAACAAGCCCAAGTTCGTGCTGTGTCATTCTTCGTCAGGTCACAAGCATGCGCTCGATGAA
GTGCTCAGTGACCCGGCGATTCAGATGCAGGTGGCGGATACCAAGGCCGTGGAAGACGTCAAGTGTCTGGAGCGCTTCTTCAACATGCTGCACATCGACC
AGGACCGCGCATACTACGGCTACAAGCACGTTGTGCAAGCTAACGCCAACATGGCGATTGAGACGCTCATGATCACGGATGCTCTGTTCCGGTCGCAGGA
TATCGCCACACGTCGTAAATACGTCGACTTGGTAGAAAGCGTGCGGGAGAATGGCGGCACCGTGAGGCTGTTCAGTAGCTTGCACGTGTCAGGCGAGAAG
CTCGGCCAAGTGAGCGGTATCGCTGCTATCCTGCGGTTCCCTATGCCTGAAATCGATGAGGAAGATCAAGACGAGGAGTCTGATTCCGAAGAAGAAGAGA
GGGAGGAAGACAGCGGAGTGGGCGACCTGTCAGTCGAAGCTTTGAGTATGTAGAGACGAGATAAAATGCATACAAGGCACAGAGCCAAAAGAAATAAACG
CTGCATCCACCTTAGTTGCCTGTGTTGTGCTGTACGACGAGGTTGGACACTCGTTTGTCAAAGGTCTGCGATGTCAGACGCTCGCCAAGCGGCGCGAAAG
GGTTCGACATGGCGTTCACATAGAGACGATGCACCTCCGCGAAAAACTGCAATCGGCGGACACAGCAATAATTCAGTGAGTACCGTAACCTCCAGCGACA
GCATATCAATAGCTTTTTAATGAAGCTGCTCGTACCGGTCTCAATTCGGATTCGCGCACTGGTGCGTCCTGCAGCACCACGACGAACTTGACAGATGTGT
TGGTCACGTAGCCGTATACTCGGTAGTCTTCAATAGGACCCAGGAATCCCAAGTACATGTCGTCTTTGGAGCTGGTGATGCCCGCGCCGCGCAGTTTCTC
CTCGATCACATCCAGTGACACATGCGCGATGTAGTGGAAGCCCAAGTCTTCGCCCTCCTCGCCGAACGTACGGATATACAGGGGGCTATTCTGCAAGACA
GGTGATAATAGATAGCATTTTTAGCTTATAGTCGCTTAGCGCTGCAGCGACAGAGACGCACTTACGGCCGCGCCGATGACAGCAACGCAGGCGATCATAA
TGCGAACGAGCGACTGAGAGACAAATGTTGTGGGAATGTTACGCGAAGAGATGATTGGTACCATGTACCATTCTGACGTGGTCAAATAAGTTAATCTTCT
TCATCTGAGTCGCGTGCTGTTGACGGAGGCGTGTACTCTGGAGTACCGTCATCTTCGGACCCCCGAGGGGAGCTCTCGTAGCTGGCCTCGCTAGTGTGCT
CTGTTGTTTCTAATGGATCTGGATGATTTGACGTTATTTCAGGTGCTTCTTGATGCGTTGGCGTGGGGTCCTCCTGCATTTGAGGGCTTGGTGCGTCATC
GTCTCCCTGTGCACTTTCTAGATGTGCAACTTCGTCGGCAATGTGTATAGGTTCGCTAGCGTCGCCAGTGTGTGGATCTAGGTTCCATACTGTGTCTTCA
ATTGCCTCTTCCCCGTCAGGAGAGTTAGTTTCGTCGTCATTAATCATTGACGCGGCCGCGGGTGCAGTTGGCTCTAAATTCCAGACATCATTGCTTGTGT
CGGCGTCGGTAGTGGCTGCATCAAGATTAGGTTCAACCTGTGCGTTTCCAGCGCCAATAGAGAACTCGCTAACTCCTGCGTCATCTTCTAGAGGTGTTCT
TGCAAATTGCACCAGTTCTTTGTTGTCGTCTTTATTCCCCACTCCGGATGATGCTGAGGTGGATTCCAAATTCCAGAAGTGTTCACCAACTTCCTTTTCA
GCTGTAGATACAGGATACGAAGGGTTTAAATTTGCTTTAGCGATTTCGTTCGTGCTGCTTCCGGAGTTACCACCCAGAGGCTCCTCAGAAGCATCACGAT
GAGCACCAGGGTCGTCTGGGTTTGAGATTATCTCCGCTACGGGCTCAGGATTTAGATTCCAAACAGGCTCGTTTATTGTGTCGTCACTATTGTTCTCCTT
TGTAGCTGCTCGAGCTGGATCTGACGAAGGCATCGGGTTTAGATTCCAAACGTTCACATCCGTGCTGTGCTCAGTAACTTTCGATTCTCCCTCTTGTACT
GCGTTCGCTGGACTCTGCACTTCCACTTCATGTGACGTTGCTGCGTCTACAAGTTTCGCATCAGTAACAGCGGAAGAATTGGGGTCTAGATTCCAGACAT
TGCTTGTGTTTCTATCCTCATTTGAGATTGATTCAGCATGTTCCAAAGGATCGTCCTGTACGTGATCTTCCTCATCGCTAAATGCATCGTCTTCAAATGA
ATCTGAGCCACCAGCATAGGGATCTTGATTCCACACAACAGCTTCGTCGTTGGTTCCGATTTGTTGACTCATTTCAGTATTTTTCCGATCAGACTGGTGA
TCGCTCTGTGGATTCGGATCCACGTTCCAAGCATTGTATTCACCTCCCGCATCTTTTTCTTTGGAGAATTCATCAAAATGCACTGAATCGTCATGTGCAC
GAACCTCATCATCGCTATGGACTGATACGTCGTCTATCGGCTCATCCGAGCGACCTTCTCGGGGATCTAAATTCCACACCTCCTTATTAACAACGACTTC
GCTCGGTATATCTGCTTCTGTCGCAGCTGCTGGATTAGGATCTGCATTCCAGATTCCAGGATTTGTGATATCCTCGCCGTTACTGTCGGTTCGTTGATCA
AGCTCGACATTATTGTTTTTATTCTGAGGACTCGGATCCAAGTTCCAAACATTGTATTCACCCACAGAGCCCGTTTCTTTGGCGTTGTCATTCGTACCAT
CATCATTGTCATCAAACTCATCATCCTCGTACGTCTTCTGCGTATCATGATCGTAAGCTTTCCGAAAACCTTCAGCTTGGTTTCCCACTTCTTCCCCCGA
CACACGCTTTTCAGCAGACTCAGCTTGCTTAACGTTATCACCAGCTTCCTCTACTGTAGTTCCTGGACTGACATCAATATCCTTATCGGTCGAGTCGACA
CTCTTTTCTTCACTATAGCCTGCTTCACGTGAAGTTATCTGTTGCAGCTCCGATTTGCCAGGGTCTACATCGCCTTGTCCTGAGTCATCGAGATTATTCC
TCCGTACATCTTCATCTGTACCAGAACCCGACATCTTAGCCGATCCATCATTTCTCTCCTCAATTTTTGTAGTGAAATCCCGAGACCTAGCACTATCGCG
AACTAGCTCCTTCCTTAATTCTTGCTGTTGACTGGCTTCAAGCCTCCTTGCTTCCCTAGCTGCTCGAATATGCAGGTTTTCCTCCAACTCGCACTCAACT
TCCAGCTGGGCAAGACGGACCTGCTTGTAATATTCAGCCTCGAGTGCTCGTCGACGCGTTTTAGTGACAAATCCCTCTCGTCGCTGATACTTGGTAAGTG
GCACCACACGAACTTGACCTGTAGCTGTCTGCGTGAATGGCATCCTGTTAGCACTCAAATCAGTTAAGACAGAAGCGTTTTGTCTGATTTCTTGACTTGT
ATCTTCAGGCATGCCCAACGGATCCAGCTTGGGTTTCTTCGACAAGGTACTAGTGAGGCCTCCGGTACCTTTAGGCACAGCCGAAACTTTAAGTTTGCCA
ACAATTGCAGTCGCCGAGGATGGCGATGTCGCTAACTTTGCTCGAAGCCGCTCGATCTCTGTATGACACTCTTCGATCTCAATCTCCAGTTCCTGGAAGC
GAAGAAATTTACTATCCTGCACGTCAGTGAACAACCACGCAACATCGAATGGAGTGCTTTACCTGCTGTACTTGAGTCGGTCAAGCTCTCGCCTCCGTTC
CTCGGCCAGCGCCTCAGACGTCGTAGCCTATCTAACCAGAGTCGGGGGCATCATATAACTGAGGATCACTGGTATCAATTTAACTGAGCCGTACCCTTTG
TATACACTCGGAGACTAAGCGGTCAACCAGCTCCTGCTTGCGCGTTTTGGTTGTCTTGGCGTCTTGTGGGGACCGTAGAATGGCAAACGCAGCTTGCAAC
TAGCAAAAACTTGCACATTAGACACCACAGTTTTGTTGATGATTACGACTGGGTGTCGTACATCTTTTTCTTTCTTGTGCAGTGTTTCCTCTAATCTGCG
AGATGCAGTTTTCAACTGAAGTATCAGTGCATCCTAGACACATAATAGACCTCTCCGTGTTAGCAAGACAATTCGGTACAGCATAGTACTGTATGAACAG
ACCTTCTCTGCTACTTGTCGCTTTACCAGCACCAGTTCCTGCTTGGTGTTTTCCCATTCTCGCCAACCATCGTCCAGCTACACAATGATCAGTATACTAC
AGTAGTAGTATCAATATTCAATATTATTTACCTCTATCTGCTGGTACGGTGTCACCTGCGAGTGGCTAGTGCTGTTGCCACGCCGACTCATTAACCGCCT
TGTCATTTTGAAGAGTCAATTAATTGCCCTACGTCGTTTCGCCTTCCCTGAAATGTAGCCATGTTGAATTGATAGAAAAGCTTGGCTTGAAACGTCGCGA
TCTGCGTTCATTCCGCAACAAAATAGTCAGCGACGATGGGCGAGGCACCGAGTTGGCAGCACATGTGGGGCGCTAAGGTCAAGATGCCCTGCGATATGGA
GGACGACGTATTGGAAGACGCGATCAAACACGTCACGTCACGACTGGGAAAGTTCGACACCGAGGAATGGGAGAAGAATGGTTTAGCGGTGAGTTTGTTG
CGTTTACAGCACTGAATTGCAACTTCTAGTGACGTAGTCGTTGTGGTTGGTAGGTATGTGAGGAGATCAAAGCTCATTTGGACGAGGCATGGGATCCTCA
TTGGGTGGTGTGTATCGGTCGCAACTTTGGCTCATTCGTGACCCACGTGACAAGAAACTTTGTCTTCTTTTACTACAACGAAAAGGCCGTGATGATCTAC
AAAGCAGGGTAGCACCAGCAGAGCACGCTAAACACCATATACTCTTTATAAAGCTAAGTTACTAGTGCTATTCAAGTTTGAGCGGAATATGAGAAGAATG
GTTTAGCGGTGAGTTTGTTGCGTTTACAGCACTGAATTGCAACTTCTAGTGACGTAGTCGTTGTGGTTGGTAGGTATGTGAGGAGATCAAAGCTCATTTG
GACGAGGCATGGGATCCTCATTGGGTGGTGTGTATCGGTCGCAACTTTGGCTCATTCGTGACCCACGTGACAAGAAACTTTGTCTTCTTTTACTACAACG
AAAAGGCCGTGATGATCTACAAAGCAGGGTAGCACCAGCAGAGCACGCTAAACACCATATACTCTTTATAAAGCTAAGTTACTAGTGCTATTCAAGTTTG
AGCGTCCACTTCAACTCTTTCATCGACTTCTGATTGGTCGAAATTTGAATTTTCGCGACAGCCAACAGTTTTTGCCACATTTTGCCATTTGAGTAGCCAT
GGCCACGCACGTCGCCAAGAAGATGAAGGTGGAGCACGAGCCCAATGGAGCCAACATCAAAGGTGACGCGGCAATGAAGACAGAGGACTGCAATGCTAGT
GACAACGAAGAAGACTCGGATGACGAGACTGGAACGTCCGCTATTGCCCAGTTTCAAAGTGAAGATGTGAGACGGTTGACACTTTTTCTTTCAATAAATT
GCGCTTATCCTGCTGCTTTTTCGTACATTCGAATAGGGAACCAATGTGGGACCGCAGCTGGAGATTCCGATGAGCTCCAACGTCCGTCAGATGGAGGAGC
TGGTGAACGAGCTGCTGCAGAACGGCAAGAACCGTGTGCCGTACTCACTTTTCATAGGTGAGACGGAGGTGACGACGTCACTCAAGTCTACGGTCGAGGA
ACTGGTGTGTGGGCAATTTAATATGCAACATCGCTGCTAAAATCATTGCAAGTACTGACTTGTTGTGATACTTTTATTCAGAAATTGTCGACGGAGACTG
CGCTGACCATCACGTTCCAGCCACTGGCGGCATTCCGTGTGCGTCCGGTCACTCGTTGCAGCGATACATTGCAGGGACATTCGGAGGCTATTCTGCACGT
GAGCTTCAGTCCTGATGGCAAGAGATTAGCTAGTGGAGGAGGCGACGCCACCGTGCGCTTCTGGGACACCAACACGTGCATGCCCAAGCACACTGGTCGT
GGTCACAAGAACCACGTGCTGTGTACGGCCTGGTCGCCGGATGGAACGCGCTTTGCGTCGGCTGATCGCAATGGTGAAATTCGTCTGTGGGATCCGCTGA
CAGGTAAGCAGATCGGTCAGCCCATGAAGGGCCATAAGCAGTGGGTGAACTCGCTGACCTGGGAGCCCATGCACCGCAATGCCACCTGTGAGCGCTTCGC
GAGTTCGTCGAAGGACGGATCGATCAAAGTGTGGAACGCTCGTACAGGTCGATCCATCGCTTCGTTGTCGGGCCACACGGACTCGGTGGAATGCATTAAA
TGGGGAGGTGAAGGTCTGCTATACAGCGCATCCCGTGACCGAACAATTAAAGTCTGGGCGATGGAGGGCGAGCACGTGGGCAAGCTCGTGCGTACACTAA
CTGGTCATGGTCACCGTATCAACACACTGGCACTGAACGTGGACTACGTCTGTCGTTCGGGTCCGTTCGGTCACAACTCCAAGAGCTTCGCGTCGCGTGA
GGAGATGCAGCAGGCAACACTGAAGCGGTACCAGGAGGTGCGTAAGGGCCAACCGGAGCGTCTGGTCTCTGGATCAGACGACTTCACGCTGTTCTTCTGG
GAGCCATCGGAGAGCAAGAAGCCACTGGCGCGTCTTACAGGCCACCAGCAGCCAGTGAACCACTTGAGCTTCTCGCCCGATGGACGATACTTTGCCAGTG
CTAGCTTCGACAAAAAAGTTAAGATCTGGAACGGCCAGACGGGCAAGTTCATTGCCACACTCACAGGCCACGTCGGCGCTGTGTATCAGGTATGTTGGTC
CAGCGACGCGCGCTTGATCGTGACAGCCAGCAAGGACTCGACTGTAAAGGTGTGGGAGCTCAGTGAACCCAAGAACGCCAAGACGACACTGTCAGGTCAC
GCAGACGAAGTGTATGCGCTCGATTGGAGCCCCAACGGCGACATGGTGGCCTCGGGAAGCAAGGATCGCACCATTAAGATGTACGTGGAGCTGCTCGATG
CTGTTTGGAGCAGCCAGGTCACTAATTTACCTCGTTTCTGTGTGTGTGTCGTGAACAGCTGGAAGCACTGAGTAACAGTTTCAATAGATTTTGCACTGGT
AGAGAGGATTTCGTACTTTAACGAGTACGCGCCAATTGATTCCCGCCATCAGCGTCACTTCCGTTTTAGCGCGAGGCAAGCGCTGTAAAATTAGGTCCAA
TATGAAGCGGTCACGCGATGAGACCACTATGGAAGACTTTGACATGGATGTCTTGGGCATGACACCGCCCCCTTCGTCTCTATGGGCCTCCATGTCGCCC
TGGAAGCCGCCACATGCGTCTGCCAAGCGCTGCCGAGACCGCTCCGTACCCGTTGGTGCGTGGCTCAAACCCTGTTGAGATTCATGTTTAAACACTGAGA
CTGACTATCGAAACGCGCTTTTGCGCAATCTTCAGACGCGATGAGCCGCATGATGTCTGCCGCCATCACCAACGCGCGCATCAAGAAGCACAGCAGCATC
GGTCGTCTTTTCGCGGGCAAGTGCGAGACGCCAAGCGCCTGCTGCGCCGTGTGCGATAATACCAAGCGTCAGTTCGATACTAGCCAGATTCAGCGCTGCA
GCCACTGCGAACGGCAGATGGGCGACTGCTGCCGCCGTGAATGCGACTCATGCTACAACGTCTTCTGCTCGGTGTGCTCGACACTCAACTGCGATGAACA
GTTCGACCGCGTCTTATGTCTGTCGTGTAACGAAGAGCGTTAGATGGCTGCTGGAACTGCCAATTCGGAGCTCTAAATTGTTTTAATTCTAAAGAAATGC
ATTTTTTTATAAAGGTATTTAAGAGTGAATTAACTAAACATGCCAACTCGTGGATCGTCATGCAGGAAACTGCGGACCATCTCGTATGCAATGGCGGGCT
GGTCATGAGGAACCATCTAATACACAAGAGAGCTTAGTGAATGAGTGCAGGGGAAAACGGGATACCGGTATGTACGTACGTGGCCGGCATTGTAAACTTT
CATGAAGCTGAGCCCATGAGAAGACCGCACGCGACCGATGCTTCGACCGTTATACTTTTGTTCATTGAAGGCTGCGGAGCTGAATTGAGCTTGATGTTTC
CAAGACAAAGCGCGCGTCCACAAGTCTTGGGACATCCAATTGACGACAGTGTCGGCGTCACCACCGTAGACGAGCACTCGAACGCCGCGTTCAAGAGCTC
GAGCGACGTTCGACTCGCTCTCCTCCAGTTGATCCATTTCTGCTAATTGCTGGAGTGCTCCGGAAGAACACAATTTCCATTCATGAGGAGCTTCACCGAA
GTAAGAACTTGCAGCAGGGGTGTTGACAAAAGCCTGGAGACGAGAAAAGCGATAACAGAGTTGAAGAGCGTCGTCTTGATGGCACTCACGTCGTATGTCA
TATGCGTTCCGACCAAGACTGCAGACTGAAGAGGAAGTTGCTCCTTCAAAGTTTGTGAGGCTTCGCAGAGCCTCACTGCAGTCAGAACTAGCACCTTCAG
TAGGTAAGTGACGTAAGTTATTTCCCTCTCTGCATTTCGAAAGCGCTGATTCGAAGTTATCGCGAAACGTTTGGAACATTATTTCGTTTGAACCAAGGAA
ATCGTAACCATACTCGTTGACTTTGAAGAAAGGGATCACAGACTCGACCCAAGCTGTTGTGGACACGACGCCGTTCCCGATGGCTATTCCTTTCAGTGTT
GGAAGTGAGCTGTCGTCGATCAATCTCAAAGCCAAGTCTGGTACGTAGTGCCCGGCGAAACTCTCTCCGAAAATGTAAAAGTCGCTCACTCTGAGCTCTG
GATGTTGCTGGTAGAATTGGTGGAGAAACTCGTGTATGTCATCCGCTGCACCGTCAAGTGACCAAGGACGCGTAATCCCACGCTCTCCATTGCTGTATCC
TGTGCCTTTAGGCTGGTCGAGGTAGACAACATTAGCAAGCCCAGTCCACGCGTACGGATTGAGTGAGATTGTGTCGGTCTCGTCGTCAAAAGAACAAGGA
CCATTCTCAAATAATAACGCGACAAGCCCAGAGCATCCAGGACCACCTGAGAGCCACAGAATCACAGGAACATTCTTTCTTTTGGCGGACGATTGGTAGT
ACACATAGTACAGACCGTTGAGCGTACCGGTCTCTTCGGCTAGATCCTCTCCACACAGCGACGTTGACGAAGGATATTCATTACTAAGAGCACTCGCTTG
GGCGAAGAGGCTCTCACCACCTGACAACATGCAACATCGCGCTAGTATCGTTACTAAGAGCAAGCTCCAAGCCTGGGGGTGCATCTTCGATGGTGCGAAT
GCAGACTTTGGGTCACTATGAAGTCGCGACCTTTTGTGTTTGGAGGCAGCATAAGATATGAGAACACGTTACGCCGCCTTTCGATAATATCGATTCAGAA
GTAAACCGAATCCATGATGGCACTAAGAGGGTCGTAAGTGAGCACAAAGTCTTCCTGCTGGAAGTCAAGGGTCTCCGGCTGCATCCCCTCCGGTGGCTGG
AGATTAGCGAGTTGGTTTGAGTTGGTCCACACATCTTGAGCTCCAGCTGAAATTGGACGAGCTGTAGCCTGAACTACAGCACGGTCCTGCACCTCAGCAC
TGGGAACACCGAGTGTAATTGGTGGCATTCGTGGGTCAACGGATGCACCTCCGAGTTTAGCGTGTTTGACAGCAGCTGCCGGAATTGTGGTTTGCTGTGT
CTTCTTGCTAACGGATAGCTCTTTCGTACTAGTCTGCGAATTATTCTGCAAGCAGGTGCTGTTGAACCTGAATCGATCTAACGCACTGATAGCCATAGTC
TGGTGGATGGTCTTGGACTTCTTCAACTGTCCGCTGCCTTGATTTCCTTCGTACGGACGCTTGTACCTGCGACGATGGTTAGTTCTCGGTTTCTCCTGCG
TTCTGCGGTCACTTTGTGCTACTGAAGATCTGTTAGATAGTCTGTTCTGCTCTCGAGGTTTTTTGTCTTCCCACTGACTCGTTCGAAGCGTTGGGATGGA
AGTCTTCAATTCATCCTGATGCTCTTTTGCGTTTGTCGCCATCAGCGAGCGAGGATGGTACAAGTCTCTCTCCTCTGTCTGCTGCGTGTGTTTGACTTTC
TGCAAGTATTGATCCATTCGCTGCTGCTTAGCATTTGTCTGGTGGTTTGTCAGTGTCTTGATGTAGCGGAGGATCCTGCTGTCTCCACTGGGAGACACAG
CCCCCCTCTCTTCCTGGCGACTTGGGGCTTGAACGGCGCGCTGCACCGCTATATTCTGCTGCCAACTCATCGTAGCTCCACAATCTGCTCAGACACATAC
GCAAGAAGAGCGACACGAGGGATGCGGACAAAATGTAGAGTGATGGTCAGCTTCAACTTAATTTTGAAATATATAAAAATAAACCAGAAATGTAAAAATA
AAGTCTATGCACTTCAATTTATCTGTTGAACCATCTCTTCTTCTTGGACTTGTGGCGACTGTACACCGCCGCAGCGCGACGTCCTCGTCGGGAGATCGTT
AGCGACGTGAGCGATGAGTTCGGCGCTGCAGACGACGGCGCTTTCCACGAATCCAGTAGAGAATAGCGTCGATCCGAGTTCACGTTGCTCATGCCACTCA
TTCCACTCTGTCGACTCAGATACGTTGCATCTGATGGCATCTCGGTCGATTGGTCGCGTCTTCGCGTTGTTGGCGCTTGCGAGATGAAGTTGCTGACGTT
GATGTTACTCATGGGGATGTCGCCTACAGCAGTCGGCGCGACGCCATTTCCATTAACCTTTTTCACGTCCACATCATCAGGTTTCAAAGGTAAACTCCCA
CGACGCGGTCGACTATCGAAGATATCCTCGTCATCGTGATAGTCGTCATACTCGGCTGCCTTTTTGGAGTGATACTGCGAATCAATCGGCTCGTATCGAG
CTCCTAGCGTCGAGTAACGTACCGACGCGGGCGATGGCAGTGGGGAATCACGTGCAACTTCGCCCTTGTACCGGAAACTACGAGGAGCTACAGCTTCTGT
CAACTCGACAGCGCCACCAGTGAAGTTGATACTCTTCGGAGGAGCTTGGATAAACGTCGCGTCGATGTCGATCTCACGATCGTCTGGTACGCCCTTGATA
TCAACTCGAATAGAAGGCTCTCTCTCGACATCCACGTTGAAGCTTCGAGTGTCGATGTCTCCTCTTGCTCCATCCACATCGAAACTTCGTGTACTCATGG
CGTTCGGATTGACAGACTGGTAATTTGTACTCACGGTACCCACCGATGGCTTCGAGTCCTGCTGTGCAGTCTTGATGGAGTTGCGCAACATGGACGGTCT
GCTTTCCAGTGTGAAGTTGTGCCAGCGCCCCATAAAGCTGCGTGAGATCTGCTTCAAGTGCATTTCCTTGGGTTCTTCCGCATGAATGATACGCAGTACT
CGGTTCACGTTGGAAAGAAGAGAGGCATCGATCTGCTCCTTGTTCTCCACGAGTCCTTCTAGGAACGCCAGCATTTGCGGATAATACTTGAGGTCTTTTA
ACCAGTACTCGGGATCATCGTTCGTCTCGTTCTCCGTTAATGTCGTATTACGCGCTTCTAAAACCCGACGAAGAACCTTCATTAACGACGGAATATCCGG
GTGTTGCATGGTGATGCGGCATGTAAGCAGCTCCACGAACTCTTTCGACGTCATATCGGGGAACTGCACTAACCGTCGAGCGATACGCAGCACGCAACGG
TACGGGAAACTCGTGATCAAGTGCTGATTGCAGTGACGCACCAGCTTGACGATCTGCTCTGGTATGCGATTGTTAGCGATGCTTTCATCAATATCCAGGG
ACGCTCGTAAAATGTGCGTCATCGCCATCGTGTACTTGTCAATTTCATCAGCCGCAGTCTTGAGGTTCTCCGGAGGATTCTGCAGATCAAACCTCATCAG
TTCATCCAGTTGAGTTCTCCACAATTGGAACAACAACTCCAGATTGTATGCTGGATTCGTGAGCCTCTCTGGGTCTGGACGAGACAAGAACCGATCAAGG
TATAACCCTGCCACGAAGTTTTGAGGCAGAGGGATGAAATCCGTCTCGTCATCGAGTAAAACCGTGTCTCGCTTGGCAACTGAACGCTCCACGCGATTGC
GAACAATCACTTGGTCCAGCTTCTTACGGACTTCAGTACGTCGGTGGGAATCCCAGACCAAGTCGCTCTTTTCGTGGTTGTCATCGAAGAACCGCGTCGC
TTTGCTGGGGTCCAAATGAACCTGGTACACGATCGGGTACGGGAGAAACCTGCACAGTCCGCTGTACATCTTCTCTCGTAGCTCCAAGTCTTTCATCAGC
AGAGCATACAGCACTTCAAAAGCAGGTTCACGTAGAGCTTCAGCTCGCAGGAAATGTTCATGGAGAACATGTTGTCTCGTTTGAAGCGCGACGCCCAAGA
TCTCGACCCACAGTCCACTATCTTGTACGTACTGAGCAACTACGAGACACGTATCACACAGCTCAGCCAAGCAGGACAACGCGTAGTAAGCTTGCTCGTA
TCCGAGATGATCCGTGATAACCTGAAGACACCACGTGAACTGGCAAAAAGGAGCCAACATCCGCTCCAAGTTGCACTCGAAGCCGCAGATTTTGTTGAGA
ATCAGCAACGCCATCTCTTGTCGAGCCAAGTAATCCACATTTCCAAACTCCGTCTCCATCGCAGTGGGGCCGTCGTTGGAGTCAGTTTTGGCTCTAAATC
CATACGTCGACAGTGACCGTCGAGACGATATCGAAACGGCCGCTTTGGCTTTATCATTACCGTCAAATGGCAGCAAATATCTGCCCAAAGTTGCCACTGA
AATGGAGGCATTGACTGCATCCTCGTCGTCCACATGTTGCTCCAGACACTCCACAATAGCCGGTCGAAAGGCAGGCAAGTCGCAAAGAAGACTCAAACAG
TCCAACGCTGGCATTGTGTCCGAATAAATACCGAGCTTGGGGTCTCTGTTCTCGTTCAGAAAGCAAAAGAGAGATTCGACAAAATCAACCGCTGTGGTCG
GGTACAGCGTATCTTCCGTGATAGCTTGGAGACCGTCCTCTGACTTCTCCAGCAATATCAGCAGATAAATTCCTCCAACATACGGCTCGGAGCTCAGGCA
ATCGTACATGTAGTGAGTGGCACTTTCCAAGAACGACACCTCGTCGCCATTCGGATCCGTGCAAAACTCTTCTGTAAGTTGAGAGAGTTCAGCTCGCGTG
CTTTCGTTCCAGATGCAGGTCGGTTCACGAATATCAGACAGCAAAATAGTGCAGAAGTCATGCCCATTAGGCTTCTCCAGTCGATCCAGAAAGTCCATCG
GAAGAAGATTCGCCAAAGCTTCAAGTCCAGCTGATCGACTATTGCCATCGGGTCCCAACGCCAGCGCTCGAAGCGCTCCGAACGCGCTCTCCAACATATC
CTGCTCCTGTTTCGCCAACGCACTGGTACTTGTCTGCTCTGCATCGAAACTCTCGGCCGACGCTAGGATCAAATACAGACCTTTCCAGAACACCCGCGTG
GACGCCATGATATGATGCTGCAGCTCGTGACTCCGACAAAGCGAAGACGCGATTTCAAACGACATTTTCTGGATATGCCACGGTTGGATATTCTCGAACG
AAAGGATGACATCGTCTAGCAGCGAATATACGCGCTGGGCGTGTCTGGACTTGCCCGTTCCGTTCTGAGACGTGTATTCCGTCGCAGTAAAGAATGATGT
GTTGTCATCGTCTCCAAAGGTGTTGAAATCGAACGCTCTCGACACTGGCACATCGTTGGACGGCGTGGGTCTACTGCTCTTTAGCAGCGACTGCACCCCT
TCTTCCGATGTTAAGAGCAGCTTCAGAATTGAGAACATGCTCTCTTTCGCTGCCAAGTCATGACCGTATGCACATCTCTCCACTAAGTCGAGCATCACGT
CCCAACTACCTTGGACGGTAACTAGAAGTGGGCCATTTTGAGGCGCAACGGAGAGCAGACGCTGCAAAACTTCCATCGCCAGGCCACGGAACTTGGACTC
TTTCGCCGATCGAGATGACAACACGCGGATAACCAAGTCAAGAGTCGACGACTCGTAGGAGAAAAACTGGAAGCCGTACTTGTCCAGCAACTGCAGTTGT
GACTTCAAGATCCGCTCGATGACATCCGATGTCTTCCCACCGCCAGCTTCGTTCTTGTGTTCTAGAGCAGCACATAGAGAATCAAACGCTTGGCGAACTG
CAGACACTTCGACCTCTCGTCTACACAGCTCTCGATACCGCGAACGCAAATCTGAAGACGAAAACGTGATATCCTCGCTCCAGCCGAAGAGTTTGTACGC
GTCTGAATGGTCCGTATCGTCCTCCACGCCATCTACTTGACGCCGTGCCAAGTATCGCCATTTCTGCTCAATACTTTTCATCATAAACACCGGATCGTCC
ACTTCTTCGGCATCTGAGTTCGACTGGTTAAACGTCGACAGATAGAAGCCACTGCAGTAGACGTCGCCTGATAGCTCCAGGTACGAGATCGGAGGGATGG
GCGTGTAGCTGTACTTCGAAGTGACACTCCTCTTCAAATTCTCCTTGAACTCACGTAAGTGTTCGTCCAGCATCTCTTGTAAGTGTAACCTCATCGGTGC
AGACCACAGCACCCGCTTGTCACGCGTACGACCAGTGTACACGTCAGCGAAATTCTCAGGGCTCTCCGTGTCCAACACTCCGATGAGCGACTCAGGCAGC
ATGTCTGTCAAGTAGCTTTGCCCCACATATCGCTCCGATGATCGCTGGATTCGATGGATGCGCTTGAGTAGTGCTGCCTCGGGGACAAAGGCCGGTACGT
TGTTGTCACCTCTGGGATTCGCCACGGTTGACAACATGAAATAAAAGGCGCCATACTTGTACACTTCCTGCAGCTCCTCGTCGCTCAAAGACATCAGCAT
CTCACAGACATATCTCCGTACGCTCGAGACATTCACAAGCAGAAGCTGAACTAGCAAGGCTAGCGACGACGTATTTGCGACCACAGTATTCACCAAAGGA
GGAGGCCACAGCTGCTTGTTCACAACCGAGGCTTTGCGCTGGTTTTTCACCATAAAGTTCCTCAGAGACTTCAACGCGAATGCTGCGCAGCTCGTGTCGA
TTGGCTCGTCCGTCAGCTCCATCCAGCGCAATTCGGGATACTCAAACATAGACTTCCATACGTGCTCCTCACCGTCATGCGTCGAGCAGCAGCAAACATA
CAGTGCGTCGATCTGGCGATGTCGAATGAAAGGGTCAGCGTCCAGATATTCCTTCAGTTCGTTTGCTGAAATGGGGCCTTTTACCACACCGTCATCGTCT
GTTCCCCCCACAGTCTTGAGTTTAATGCTCCATCTGAGCGCATACCGTGATTCTTCATACAGCGAAAGCTCTGCTATGGGAACGGAAGAGGTGTCGTTGC
CTTCCGACATAATGAAAGACTCCATCATGGGGATTTCCCCGTGATCATTGCTCATGTCACTTCCAATGGGCGCAGTCTGGCAGCGATGGGACAGCAACGA
CATGTCCAGCAACACTTGGATGTGATTCTTCGTACACAACTCGGCACAGGCGTCTCCAGACAGACTCAGTCCAGACATTAACTCCACGATGTCTTGGATC
TCACTAGCCAGGTACGAATTACGCAATAACTCGGTGAGAAATCGAGCGCGATGTTTCGTAATCGACCGAGCTTCCGGGAACACGTTGGCGAGTTCGATCA
AGATCTTCAGCATCGAATGGCCGTGTTGCTCGCTTCCAGTAGCACCAGTGAACTGAGGGAACCCATTGCTGCCACTCGCAGACCAATCGTTCGTCCCTGA
CAACGGAATATTGTTCAGATGAAGATGCTCCAGCCAGCACTGATACACTTCACTGAAAAACTTAGCCGGGTCCTTGGCAATGTCCATGCTGGCAAAGAAG
AGACTGCTCGAGTTTTTCAGCTTGCCTCGATGTGTTCCAGCCTCCAACGCCCGAGCAATCTTGGCGACTTCAGCCAGCTGCAACGACCCATCGTTTATCC
TTTCCGTGATCACGCGTAGATAGAATCGGTCGACTTGAAGCTCCTGCGCAATACTCTCGTATCGAACCGAGAACTGCACGTGATTCCACTTCGGTTCTTT
GCTTTCTTTCCGAGAAACCAGCAGCGACAACGCAGCTGCTTGGTTCGCTTTGAACTGATCGAATTCCTGGATCGCAGACGTGAGAGCAGCTTTCAATTCG
TTTCGAGTGGCTTCGTGCCACAGCAAGTCTGGCAGCATAAAGTCCTTGCTCACCATACTCGACAGTAACGCCATATCCGTCGATGACTCGCCGGGATAAT
TCATACGCGTCGAGTCCTCCTTGACTCGAGCTTCTTTGACCGAGCCACTAGCAAACAGCGTGCCGATCTGGAGCTGCATGCGACGAATAAACCACTCGGA
TCCGTCCCCTTGGCTCAGTAATTGATGCTTGGTCTTCCGTCGCACAGACTCAGTCTGTCGAGCTCGTTGTTTCTTCAGCAATTTACGCACCATCGGGCTC
GAAATCATGCGGATGAACCCATGCGGAAGGATCCGCACCAGCATTTCATGAGAAGCCTTGTGATGCGTCACCCAGATACTGGCGACGTATTGATACGTCT
CCTTCGCGTTGTCGGACGGGTGGAAGAACGCCTTGTGCAGGTGTTTCAGAGTAAGCCCCGAGTCCAGCGCATAGTCGCAAATACGTCGTCGTACTTTATG
ATCTCCGTGGTCAACAATCACTTTCAAGACACAAATCACCGCTGCAGCCAAGCCTGCGCTCACGTTTTGAGCTGCCAGCTCCAGCAACAGCGTATACTTC
CCGCCGAGATCTTTCACGATAGCATCAAAGTGGTTGTTGTCTGTGCTGTGCCGAGACACCACCAGGACGTCCAGAACCAGTTGCAGCATGACCAAAGTGG
AGATCGGGTTCCGTTGTTCCAGAAGGCCAGTGAGCAGGGAAATGAGCTTCGTATGCTCAAACACTTGAAAGCGAATCGCCTTTTCAGCAGCTCGATGCGA
ATTCGACCGCGATTTGTCAGCGATTAACGAGTGGAAAGCGTTCACAGCCCACACAGTGGCTATCGGATCTCCAGAGACCAATATTTGAGCCAGAATCGGA
ACCACTACCATCGCCCCGCCGTTAGCTTGCTCCATCGATATCCGATAACAGCCGTCATTGATTCTGCAGAATGTTTCCAGGATAACACAAATCTCATTCG
CACGAATTGGTGGCTTGCAGGAATGCTCGAGCTATTTCAAACGTACAAGCAATTGCATAACAAGTGTTAGTCGCCCCACACATACTAAAGAGTGCACGTT
TGTCGTACCAAGTTGTGGATCCCTCGAAGCAGATAGCTGAACGACAGCTTCTCCAAGCGACCACGCATAGATTTCCCCGCAAAGTCCTCGACCTCGACAT
TCATATTTAAGCTGTCGAGAGCGAACGCGACCTTGTTAGTGGCAGATGTGATACTCACGCCTTCCCCACTCATCATTTCAATCTCCTTCTCCAGTACTGC
ATGGGCTGGAATGTAGAGTCCATCGTGATTAAGATAGAGAAAGCGTTCATGCTCGTCCTTCAGCAGCGCTCTAGGAGACATTCTTGGGTTTAGGTTGGAG
AACTCTCGACTTAGCGAAACGTCGTAATTGTCCACATAGCGATAACCATCATACAACGCTGCCAGGAACTTCTCCATTTCGTACGGCACATAGGCCACAC
GACTGCTGTCCGAGAACTCCAACGCCACCACAGCTTGTGTTTCATCACTTTCCAGTCCAGGAACCACTACACGACGAAGATTCTTGAGCTCATAGGTCTT
CTTGGAGCAATTCGTGAACTCTTCAATCGTTCCGTCCACAAAGCAAAGCTTTTTCTTCCGTAAATGAGTAGATCCATGTCGACCTGTGCGTCTCTGGACA
TCGAACAGATCATTCGACTGGAAAGCTGATTGATCCAGAGGCTTTTCCGCTTGCTGCTTTGGAAGTTTGTCTCGAGTCTTGAAGCGAAGATGGATCCCAA
TAACTCCAGCCAAAGATTTCATTTTCTCGACGATTTCGCTGCTTTGGTCCGAGTAAATGAACTTGAGTTTGTTCTTCAACATGAGGATAAACGCATCTGG
GATGGTCGTCGCTTGAGTGATCTCGTCGATCGCGCGGAACTCGAGCTCATGAGTATGTTTCGTCAAGATCCGAACAGCGATCAGCGCTCGCGGGGTCAGA
TAAAACTTGGTCTTCTCTCGTTGTCCATCCGCTGTGCCGATAAAGCCGCTGAACTGACAGCAATCCACACTATACACGCGCTTGAACTCCTCGAAATTCC
CCACCAAATGACTCATGAGTTCCTGCAGGAACACGTTTCGACATCTGTAGCGAAGCCGCAAGAAAACCGGGTCGTCGTACTGATCGATCCCCATCTTAAG
TGAGCCACAGGCTGCTTCGAGGAACTGTCGATACTGCCTCAGCAGCACTTCCGGGTTCTGAACGACCACCACGTTCGCTGGAAGACCTGAAGCGCCACTG
GAATTCGATTCTGACGACGACAACGTGTTGTTCCGACCAGATGCGCAGTTGTTTCGTCTAGAAGAGTACAATGCGGGACGAGATCGAATATCCGTTGACG
CTCCACGTTGACTTGCTGGACCAAAGTTCAAAGTCTCGCCAAAACTGAGCGATCGTCTCGGAATTTTCCCATCGTTGGACCGTAAGGGAGACCCCATGTT
GCCAAAGTGCAGGAACGCTGGGTTCTTCGTCATCCTGCTGAGAATCCCCACACACGCCTCCACTGTAGCTAAGCCAGGGAAGCTGAAGAGAACTCGAAGC
ATCATACGATACTTTGTGGCTAGATGTTGGTATAATGTCTCGGAGAGTTTCCGCTGCTTCTCGACGTTCGCCTTGACCAGTAGCAGAATAAACTGACACA
GCTTCATCGTCGGTAGATCCGACAAGAACGCACCCGTCTACACAGCACACGCCCACGCACTTTAAGACACAAAAACAACAATATAACCAATCAATTGCGG
GTCGTACATGGGTATCTTCGTCCAGTAATGAAAGCAGCGTCATCATGAAGACACTGTTGGATAGCAGCAGCTGTCGACACTGCAGCTTGTGCGCCTTTGA
CTCCATCAGTCGACTCAGCACCATGAACATCCAGTAGATAGCCACCGAGTTCTTGCTCATCAGAACTTTCGAGATCAAGCCGATATATTCCTCTCCACGC
TAGACAAGAGACAGTCAGAATTAGCATCTCAGGAGCATTTTTCAGCTGGACAGAAAACACTGTACCTCTGTCAGGATCTTCATGAACTCGTTGATAGCAG
GTGGAGCGAGCGTCAAACGATAGAGCGACTGCAGGTATGTGCTCACAAAGTCGTGTGTGGCTCCATGTCGACCAACAATGTCATGAAGCTCTCGTGCCAG
CACGTAGACCACCTTATCGAACGGTTTGTTGGGCTGCGCTATCACACCGGACGTCGGTGTATTCGCATTAAGTTCCAGAGCCAATAAATGCATCTCTTCG
TCAAGTCCACGAGGAAGTTGACGTTGAGTGCGCGCCGTCTTGCGATATCCATGTACCGCCAGTAGCTGCAGCACATTCGCTTGAGCGACTCGGAGCTCAC
GGTCCATCACGTTGACATTAGACACAGTATTCACGATCTTGTTGCCTTCCTGGAGGATGATCCTGCGCGGTATCATGCGCACAGAGTCGGCGATCTCCGT
CATCTCCACACCCACCTGATAATTCCCCAGAGCGTGGCAGGAAGCTAGTAATTCACACACGATCTTCTCTCGTTGAGCGGAGTAATACTTGCGCTTGACG
CCGTCCACATACACGACTTCGAACGCTTGTAACGTGTCCTGATACATGACCAACGTGTAGATTCTGGCCAAGGGACGACTGGAAATCACCGTCTTGGCGT
CTGCATACTCCGTAATGAACTTCTCCGACACCAAAAGCGTCCGTGGCGCGGCAGTGGACTCGTTGGACTGGGAAACCTTCAAAACTTGATACGCAAATGA
CACGCTAGTGCTAAACGACGCCTTCCCGTCGTCTTTCAGCGCCGCTTCCATTGTTTTCTTGCGGTATTCATTGATCTGCATCCCGTACGCCTTCATGACT
CGATTTATAGCTTGCGCGAGCTCTGTGCGTCTTGGTACGATGAATAAACTGGAATTATCCGAGTGATTTAAGCCAATAGCTTCATGATCGTCGCAGATGA
GGTCGATGGACACGAGACTCGTGTACGAAATGTGGCTCATGATGTCTCCCTCGGTATCTCGCTGGTAAATACCGTCCGGACGGATCTCTACGACGCAGGT
CGAGTGTACGCCGCCCTTGTGGCATTTGAGACTCTGGAACGTCAGCGTCTGCAGCTCCGCAGGGGGCGGCTGAGGCGCGTCGGGCATCTTGGCGTAGTGC
TGACTACGCAGTCGCATCAGACACACCAGCACCTCCATGCGGAAGTGGCAGCGGTACACGGTCTTCTTAATGCGGTGGCGTGGCGTGTGGATGACGAAAT
CGGTCTCTCCTTCCAGCACGTTGGCGCTGTCCACGTCCTCATAAGGCCACGTGTTGGTCACCTGTTGGTTCTCGCGATCCACGGTCGAGAAGGAATACTC
GCCGAAGCACAGAACGCGCTCTTTGACCACGAAGCTCCCCACCTTGTGCACCATGAAGCGCGCCACCACGCGCTTCATCTCCATGGTACAACTCAGTGTT
GGAGCTTGTTCACTTGTTTCTCTTTTCTCTTTCTGACGCTGCGACCTGCTCGGATAGCCCTGTGCTGCTGGATTCTTCTCCTTCCCCTCTGCCCGTCTCG
GAAGTCTTGGACGATCTTGAGGCGTATTCAGGTCGGACTAGCGGCAGAGAGTGCGAAAGGTCGCA