Description :
From Genome Similarity Track
Location :
Scaffold_897:2318- 8535
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_897-snap-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_897-snap-gene-0.3Intraflagellar Transport Protein 140

Sequence
6217 bases(100 bases per row)
CGAGCCAATCTGCTGCGGGTAGTTGGCGGCCGTGACGGCGTCGATGGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNACAATGGTCCGGCAAGATAAAAA
ACCCTGGCAAGCGCTACTATCTCGCACTCGCCTCGAAATCGGTCCGCGACGCCAANNNNNNNNNNTGCGGCGGTTCTGTGGGAGCGGAGAAGCGTTCGCT
GGCGAGGAGTGATGAATGCGACACCCGATCGCGAGGAGCTCTTTGCGTGAATGCGAACGGATCTCACACAGATGGCCGACCATCACTCTTGATGCCATGG
CTTCGATTTCTATTTCTATACTATGGGTTTCTATTTCTATATACTGTATGTTGATGTTGTGCTGCTTCCCAACAGCTCTCGACCAACTACGTGGTTTTAT
CAACGGCAGCGTGACGGTAGGAGGAGGAGCNNNNNNNNNNCTATTCCTACTGTATGTTGATGTTGTGCTTCAACCACGGATCTCGTGAGCGAGTCCCAAC
AGCTCTCGACCTACTACACCCATCACGGTAATTAGTCTGAGTGTGCAAATAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGAACTCGCCCTCCATGAACTACGCAAGAAAAGCAA
CGACCCTAGCCCGAAGAGTTCGAGTTTGGTCAAGACGAAGACAAGTCAGATCAAGATGAAGGCAAATCCGCTGTGGTATATTATCTCACACATACCGTGA
TCGGTGTCCGTGGTTTTATCAACGGCAGAGTGACGGCAGGAGGAGGAGCGAGTAGCTCAGCGAGAGGAGACCGTGGCGGCGGCGAGTAGGCGAAGCGTGC
ATCGACGCAGCCTTTGCTCGTGTCGTGTTACAGAGCGAAGCAGCTCCACTCGGTCGTGGGCGCCGTCTCGAGCTTGTTGGAGACGGTGCCTCGTAGCGAA
TTATTGTGAGTTTGGACCGGTCCGTCCAATCGCGTGGTGCGTTGACTGCTGGAAGGGGGTTTCAGTGGACACTGGCCGCTTTGATGCAGTGCATAGGGAC
GACCTGCAGTAGAGAATTGATCAATGTGAAGCTCATCCATCCGGCTCGTCAGCATAGTTCTGCGCGTGGAGAATGTGGAGCCGCGGGCCGCGCACGCGCC
GCTGCTGCTTGGTGTCGACGAGGCGCTTTATCTCCAGCAGCTTGCGCGCATTGGGGTGGCGCTGCCGCAGTTCGTCCTCTGGTTCTCGACCACGTAAACG
ATCGGAACTCCTTGTTTGTATGCATTGCGTCGTCCGCAGCGAGTGCTCGACGTGTGCCTCCGCCACTACCTCTGATTGGTCCTCTTCATCCTCGGGCCGG
GCTAGCGCCAGCATCTTGCACGACCGGTCCGTCTGGTACGTTCGTCGATACTTGCTCAGGAGCTTCTTGCGAAACGCCTTGGCCGTCTCCTGTTGTTTCA
GCTGCGCGCGCTCGTCGCGGTAGGCGGCCAGTTGATCTGGGTACCTGCTAACAGCCCGCAGCGCTCGGCACCGTTGTGTAGCGTGGTGTCTCCGGACCAC
GCGTTGGATTTTCGTGGCGGGTGACTGCTGCAGGCCGCGCAGCCAGCCGCGCTGCCGCTTGAACTCGACCATCACGAGCCGCGTCGCGAGACCGCGCCAC
CGCGACTGGATACAACTCACGAGCTCGTGCTCGCGCTGCAGCATGCGCCGCGTGATCTCCATAATGTTGCTTTCCACTTTAAACAGCGGTGGCTTGCCGC
CCGCGCGCCGCACAAACTCTCGGTAGTTCCAGTATAATATCTGTAGCTCCCCGGTGTGCTCGTACCAGAAGACGGGCTTGCGGTCGGGCGTGGCCGCGAG
CGCAAACTGGAGAATGCTCGGGTGCATGGTGCGGATCACGCGCAAACACCGCTCGTACAGCGTGCGCGTGCGGGCCTGTATGCCTCGGATTCGCGACTGG
ATGCGAGTGGCCGCAACACGGATGGTCCAGAGGTGCAACTCGTGGGCACGCCGGCGTCGCCGGAAGGCCAGGCGGCCGAGAAAGCCGCGGGCGATGCGAA
GGAGGAGGTGCGTGGCCGGCACGCGCTTTTGCTCGAACGCTTTGATCTGCTGCTGTTCCTCGGCGATCTTGTCCTGGAAGCTCACGACGCCGGCGCGCAA
GTACTTGGTCGTGCCGCAGCCAGAGCATACGGGCAACTGCTCGTAGACCGACAGATCGGGCGTGGTGCTCGTGGTCTCTGTCCGTGGCTGGCGCCTTGTT
GGTCGGACACNNNNNNNNNNCTGTCTGTGGCTGGCGCCTTGTTGGTCGCACACGGTTCACGTTGATGAAAGTGACGCTGTTGCAACGCTGACATGTGAGG
TACGGGGTGCGCAAGTCGTCACGCAGAATCCCTGCGAGAGCCTCGCGCCGTGCGATCTTGACGGCTTCTTCTTCTTCCTCTTCTTCCTCTTCTTGCTGCT
CGCCATCATCGTGGCCACCAGCGACGATGGGTTTCTTTCGTGGCTTCTTGTTGGGCTTCTTTAACGGTGCTGTTGGTGAACTCTGTGGTGTCGTCATCGA
ATATGCAGTACCGCCGTCTTGACCATCCTAATAGACTCACGTATCGAGTCCCGCGAAACGGCGTGACGCTTCAAGATCCACCGTCGTACTGAAACAAACC
ATCTCCGTCCTACTGTATGAAAAAATCCAATGAGACAAATCCTCTCTCTCTCCCTCTCTCTCACTGTCGCTAGTCCTCCTCGGCAATCTCTTCGTCCATG
TCGTCTTGTCCATCTCCTTCTTCAATCCGGGGGGACGCTTTCCCGCCACCGCCTCTTCCTACAGATGCCTTTGCGTCGCCATCATCCTCGCGAGGGGACC
GCTTGCTCTCGCGGCGCTTGGCATCGTCGTCGGAAAGACCCATCTTCTGGGTGATCTCCTGGACGATCCGTGGGTCCACATAATTCTTGACTGTGAGGCG
CCGCGCCTTCATGGCCTCCATGGCCGCGTGGGCTTCACGAAGGTCGCCGTCCTGGTAGTGCGCCTCGGCAATCAGCGCGTACGCGTCGCCCACACGGATC
GCCTCCTCAATACCCGGCTCCTCGAGCAGCTTGGTGACGACCTCCATGATCTCGCTGGCGTTGCCCTGCTGCCGCATTTGCCGCACGGCCACAAACTGGT
CCACGAGCCGGATCTTGTTCTCGAGCACCTGTTGGAGCTTGTCCTTGGTCTCGCCTTTCGCTTTGGTCAGCACCTTGGCGGCCTCGTGGAGTGCACCCAG
CGCCTTGTCATAGTCACGATAGTCGTCCATCTCGGCTTGAGCACATGACTGGTAAAAGTTGGCGAGCTGCTCAAACGCGCGGGCCTTGGTGTAAAAGCCC
ACAATGCTCTTGAGCGTCTCGGCGTCCTTGCGCCAGTCGAGCGTCTGGAGGTAGTTGGCCGCGAGCACGTAGATGGCATTGTTCCGCGACACGTTGGCAA
AGAACACGACCTTTTCCGTGTCGCCCGACTTGAGCAGACACTTCATGGCCTTCACCTTGTCGCCAGCCTGCGTGTACTTTTTCGTGGCCAAGTGGAACGC
ACCCTGCTGTTTACAGCACTTGGCCAACTTGAGCAGCAACTCGGTGCGGGCCTTTTGGTCGCCCGGGTCGTCCTTGGGCGGCGTCATCTTCTCGGCCATA
TCGTCCGTGATCTTGACCTTGTGCTGGAGGCACACGTCCAGTGCGTCCCGCACGCGGCCCGCGACCAGCAGCAAGTGCACGGCCTTAGCAAAGTGGCCGT
TCTGGAGGAAAAAATCGGCGCATTTTTTTAGCATTTGCGGGGACGAGTTGCTCGGGCCGAGCTCCTCGGTGAGAAAGTGCAGCTCGTCAAAGAGCTGCGC
CGAAAAGCACAACTCGAGCGCGCGCGCCACGTTGCCGCCCTTGTGGTAGAGCTGTACGGCCTTTTCCATTTCGCGGCGCGACTCAAAGTAGGCGGCACAC
TCGAGCATGTCGCTCGGCTTGCTCAGCAGCGCAAAGCTCATGAGCTCGGCGTCAAGCTGGTGCTCGCGCGCGAGCCGGATCGTATGGCTGTAGCAATTGC
CCTGCGCGTAAAACTGGATGGCGCGGGCAATCTCTCCTTGGGCCTCGAGCTGACGCGCCAAGTGGTAAGCCGCCGCCCGGTTGCTCGGGCAGTTTTCCAC
GACCTTGGCGGCCGCCTTGAAGTCCTTCTTAAAGCACAACACGCGCACGATCGAGAGATCGTCCTGTGCGCGCTGGTAGCTTTCGATCGCGAGGTCAAAC
TGGCCCTGGCTCTCCTGAAACTGGGCCCACCATATGAGCAGCGCGCGGTCCTGCGATGTCTCGACATATTTTTGCAAGAGCTCGAGCTTGTCGAGCTTGA
AGAGCATGCGCGGAATGTCCTTATGGTGCGTGCCGGCGTCCTCGTAGGCCTCCATAGCCTCCTTGATCTCGCCCAGTGCCTCATGGTGCTGTGCCAATTG
GTAATGGGTCGTCTTGAGGTGGATACGGTCCCGCTTGGCGGCCACATCGATGGCCTTTTGCCAGTACCCGCTCGCTTGGTACAGCTTGTTGAGCTGGTCA
AAGCGGCCGCACTGACGGTAGAGCTGCGCAGCCTCGTCGCGCAACCCGAGCTGAATCGCGACCATCGCGATGGGCACTTCGAGTTGCGGCTCGAGCTTGG
CCTCGCTCACGGCGGCGGCGCCGCGCGCGTGGCCCATGTTACCCAGACACACTTGTGCGACGTCCAGGCGCTTCGTCTTGACGCACATGTGGGCCATGTT
CTCCCACACTGAGGCATTGTCAATGAGCTTGACCGAGCGGTACGCCTCGTCCATGTTGCCGATCGTCATGAAGTAGCAAAAGTCGATCAGCGCCGCACGC
GCCGCGTCGTTGACCTTGTCGAGACCAACAAAGTCGCGCATGGTCTTTGGTCGCAAGTAGCAAAAGCCCGCGGCGTCGTGGTCACTGGCGGTGCGGTCAG
CGTTCGCGATCAGGTAGATGCGCGGCACGGTGATGCCCAGCAACGCCGAGTACTTGAGATCCAGATCAAAGCTGTCCTGCATGAGAATGCCGTGATCGTT
GGACGCAAAGCACACGATGATCTCCTTGTCCGACAGTGCGCTCGAGCGCGGCTCACTCTCTCCTCCGCCGGTGATCGCTTTGCCACCAGCGGCTGTAGCT
GTTGCCACCGCTGCCAGTGGATCCGACCGAGTCTTGTAGGTTTCACAGGCGAGCAGCCGCGGCTCGACCGGGTCGAAAAACACCGAAAGTGGGAACCTGT
TGACGCCAAAGTCGTACTGCTGAAAGATATTGAGATCGCTCTGGAAGAGGAAGAGTTTACCCACGGGCATGCGGATCTTGAGCGCGCCCTCCATGCGCTC
GGCAAGAATCGCGACGCGCGTGCCGTCAGCGTTGACTGTGATGGCACGCATCGAGGCGAGCTTCGTCTCTCCCTGGAAGGCCTCCGTGAAATTGCCCATG
CTGCCCATGGCCTTGGGGTCCCGCGACTTGAGATCAAATACCCGCAACAGGCCGCAGTCTGTCGCGACCGCAAGGAACTTGTTCTGCACCGACAGCAACG
CGGGCTTACCCTCGGCCTCCGTGAACGAGATTGTCTTCTTGACGACGCCCTGCATGTTGCAGATCTCGACGTGGTTGCTCTGCGTGCGGTAGATCGAGTC
ACCGCGCAGCACCATGGCCGTGGACACGCACTTGAACTGCGCGATGCGCTTCGTGGTCGAGTCGTTTCCTGCCGACTCGCTGCGTAGCTCAAAGACCTCG
GCCTTGGAGCCGTTCCACACGACCAACGATGCACCGTCATGTGACACGCCCTTGATACGCAGTGAGGTTTCGAGCGTCGATTGGTGGATCATGCCGTCGC
GGAACCGCTCGACCGAGAGCACGGACGGACGGCTCTGGATAACGGCCGTGTCGCCGCACAGTGCGCGCTGCATGCTGCCTTCGTGCAAGATCACGACTGC
GCCCTCGGTGGTCGCTG