Description :
From Genome Similarity Track
Location :
scaffold_466:2318- 4715
Transcript NameFunction/comments
Pl_104625myosin-like protein

Sequence
2397 bases(100 bases per row)
GGGCGCGCGTTGCTACATCCCGGACGAAGATGCAGCATGGCTTCCTGTGTACGTTGAAGAGGTGAACGAGCAAAAAGGACTCGTGACGGTCAGAATTCAG
CGTCCCCGAAAGGATCAGCAGAATGAGGACTCAGCTGACCATGATGACGCGGACAGGACTGGAGAAAGTCGTGTAGTTTCGATGGATGTCGGATTTCCTC
TACAGAATGCACAACTTTCGAGATATGATGAAGGTCTCGACAACATGATTGATCTTAATCATCTCCACGAAGCTGCTATTCTACGGAACCTCAAGAAACG
CTTCCGAGCACGGATGCCGTATACATACACAGGAGATATTTGTCTCGCTGTGAACCCGTATCAGTGGCTGGATGAGTTGTATACACCTGGTCTTCACAAG
AAATATCTACAAGCTCGGAAGCGACAGGATCTACCTCCTCATGTGTATGCAGTGTCTGTGGCGGCTTTCAGGCATATGTGTGATAATGGTAGCAATCAGA
GTATCCTTGTGAGTGGAGAATCCGGTGCCGGAAAAACCGAGACTACCAAAATTCTTATGGACAATCTTGCCACCATTGCCCCGGCGCCGACCAAAACTGC
AAGTGAACAGGAAGATAATATCACCACTCGTATTATTGAGGTGAATCCGCTGCTCGAGAGTTTCGGTAATGCCAAGACTACTCGCAACGACAATTCAAGT
CGCTTCGGCAAGTTCACACAGCTTCAGTTTGACAAGAACCATGCACTGTGTGGTGCTCAGTGCGAGACATATTTGCTAGAGAAGACACGTGTTATTTCTC
ATGAACGCGGTGAGCGCAACTACCACATTTTCTATCAGCTACTGCATGGTCCTTCAGAAGAAGAGCGTGACGCGTTGGGACTGGGAGCAGAAGCACCAAG
GTTTGCCTACCTCGAAGAAAAGAAACCCCAGCAAGAAAATCGCCCAGGCCGAAAGTCGAGACCTAGTGCTCCACCACCGCCAAAACCGGTGTCTGTGATT
GAAGCTGAGAATGCCAAAGACCGAGCGCTCTTTGCGAAGACAAGGCAAGCTCTCTCACTTCTAGGACTTGGTCCAGCACAACAGAATGATCTGTTCCAGG
TCTTGTCTGGTATTTTACACCTAGGTGAGGCTCAGTTCGTGGCAAAGCCCGATAATGACGAAGCTTGTGACCTGGATAAGGACTCAGTAACCTATTCGAG
CATGTTGCTTGGCTTGAACCCGGACACCATGGCTAAAGCACTGACTCACCGAACTATGAAAGCTGCTGGAGAAGTTTACCTGGTTCCGCTCACGGTGGAG
CAGGCTCAATCAGGACGAGATGCACTTGCTAAAGCTATCTACGCCAGCATTTTCGACTGGCTCGTGGCTGGTATCAACGCCAGCCTGGGTGCCGCTGCAC
GACTCACTGCGAATACGATCGGTGTGCTGGATATCTTCGGTTTTGAGAGCTTTGAGCACAACTCGTTCGAGCAGCTTTGCATCAACTATGCCAATGAGAA
GCTGCAGCAGAAATTTACTCAGGATGTGTTCAAGGCCGTGCAGGAAGAATATGAACGAGAACAGATCACGTGGGCTCATATCGCTTATGCTGACAACAGC
GAGACACTTGCTCTCATTGAAGGCCGCATGGGTGTGTTGGCTCTGCTGAACGAGGAGATTGTGCGTCCACGAGGTAACGAGGAAGGATTTGTGAGCAAAC
TTTCAGGTGCCTACCTTAAGGAGAAGAAACTTATTGAGTTCCCACGGATTTCCAAGACGCAATTCGCCATTCACCACTATGCCGGAACAGTCAAGTATGA
GGCTACGGGGTTCTTGGAGAAGCACAAGGATGCCCTGCTTTTGGACTTGTCGGATTTGATGTGTGGCAGTCAAGAGCCATTCCCTAAGATGCTTTTCATG
GTGAAGGCTGAGATGGAAGCTGAGGTCGCTGCCAGCTTGAAGCGTTCGACTTCAGGAAGTCGAAAACTTGGAGGAGGTGGCGCTGGAGCGGACAAGACAG
TCGGCATGCAATTCAAGCAATCCCTGAATTCGCTCATGACCAACATCAACGACACGAACGTCAACTACATTCGGTGTATCAAACCGAATAGTGTCAAGAG
CTCCACACTACTCGAAGACAAGATGGTTGCCAATCAACTGCGCTGCGCTGGTGTCATTGAAGCTATTTGCATTGCTCGTGCTGGTTATCCGAACCGATTG
CTGCATGCTGAGTTTGCTGAACAGTTTGACATTTTCCTCAAAGAGAAGGAACAGAACCAGCTTAAGGATGATCCAGAGAAGTATGGTGCACCTTACTGCC
GTGTCTTGGTAAAGCAGTTCAAGCTTGAAATGCCTGAGGAGTACCAGATGGGTGTGACGAAGATCTACCTGCAAAAGGGTGTGCTTGAAAAGCTGGA