Description :
From Genome Similarity Track
Location :
Scaffold_3:2317723- 2328761
Transcript NameFunction/comments
Phyin_T30-4PITG_02495Phosphatidylinositol kinase (PIK-L4)
Phyin_T30-4PITG_02496Putative uncharacterized protein

Sequence
11038 bases(100 bases per row)
AATGTTACGCTGTGTGGATGCATGCCGATTACAGATGTGAACCAGCTTTACGAACGCAGAGAGCAGTTAAAGAAGATGCTGCCGTCTATTCACGTCAGTT
CGTATGGTATGGTTGTGGCGCTTCGGCAATCGGTGATAGTGCTAGCGGATCGGATCGTTCGAGAGCATAACGCGATGCTGGAAGGCGACCAGTGTTTCGA
CAGACTATGCCAACTGGTAGAATTGTTTATCAGTAAAAATGAAGAACTTGCGAAAAACACCGGCGGGGAGAGCATGAACGGTGCTGTATCGAGCCAAGAC
GCGGACGAAGTCACACGAAGCACACTTCGATTATTGCTCACCATCTTGCAAGTCAGCGTATCCACTGAAAGACGGTTTGTCCGCTTGAGTTTGATGTACT
TGAAGGACAGCTTTCTTCGTGGAGCGAATGCGCGGACATGGAAGGCCTGTGCTGCCATCCTTGAGCTAATTAGTACGTCTTATCCTCGTCTCTCCAAGTT
TGCCAGCGATGCGTTATGGCCATGTTTCGAGTCGTGGGTATACGGGAATATGGATCAGGTTCGTGGGGCTGGTCGTGAGAGAAAACACATCGTGGAATCG
ATTTGGATGGCTGTCCTTTCGATTTTGGATGTGTACACTCGCCAGTCGAAAACTGCGTCTGCCGCTTCATTATTTATTGACATGTTGGAGCTTGTCGATC
TAAAAGTATTGAATCCAGCAATGACATCAAGTGTCATAGATAAAATCCACTACGTGCTCTCGGCGAAGGAAATGCTGACGAAAGTGGTTCGATTCATATC
GAAGGAATTAGCCGGAAATGGGCCAAGCGCGATGAATCTAAGTCAAAGCGCCAGCGCGTCAAGGAAGCGGAAGCGAAATAATTTGTTATTGGATACACGA
GATTCATCTGCCGGATTGCGTCGAGATAACACCACCGAGTTGCACGAAAAGTTAGGTCGATGGCTACTTGATCTTATTTCTTTTGATAGTGGCAGTGATC
GAAAGAGCATACTGGGTATCTCCACTGGTTTGCGGGTGATTCTGCCTCTTCGTCGCTACATCGCAGCTTTTGCACGACTAGAGAGTTTTGCCATTTTCCG
AGCTCTTCTCCAGCGTGTCGATTTGATTGTGAACACTTACGCGCCGTCACTCACATCCCTTACTAGCGAATACTTGGATTTATGGATCATCTTGCTGCGG
TATTTTGACGATCACGAAATCGAAAAGTATCGTGGTCTGCTTACCAAAGTTGTGGAGAGTGTGGAGACTCAAAAGATTTTTGAACGTAGTTTAGAACGGG
ACAACGCGTTCGTTGAGCCAGACTGTTGGGAATACTTGGATTTTCTACAGTTATACCAACGTCACCCTAAGTGCCACGACATGTCCCTGTCGGAGAGGCT
CGATGAAGTGTCGTACGAATATGTTCGGAGCGCAGATACTGTACTCGAGGTTCTTTTCCGAAAGTCAGTGGCCCTCCGTGGTCCATTCTTGGTATACTTT
GTGTGGTCACGTCCTGCGACGCTCAATATCGTCGCCGAGGATTCGTGGCGGAATGCTCTACCATGGAGGATTGTTTACCGAGCGATATTGCAAGAAACGT
CGCTTGATGTGACAGTGTGTTCCTACCTTGCTATGGCTCCACTTCTCGCTTTCTTTGTGGTGGCTGGATCTCTAACCTCCCCAAAGAAGATGGCTACTTG
CATCATGGAAGCCTTTAATAGCAAAATTCAGCGCACGGGATCAGATGCAATTTCGTCGGCGATAACTCAAGCGTGCGGGGCGGTACTCTGCGCAACGGCA
TACGGTCAAGCATCCGCTGAGGGGGTGCATTATTTCAATGACAGAAGAGCAAGTGCCGTTTGTTGTCACTCCAAAAGCTGCCAATGTCGAAAGATCGCTG
ATGGTTGTCAAGCGATGCCGATCCCATTATCGTTGTTCGAGCCAACGATTTGTGGTGAGATTGGCAGTGCTACTGAAATCATGCAGGTCGTCAAAGTCAA
TGCATTGTCGAGCGTTTTTGAGCATTGTGAGGTTGATTATGGTAACGATTACACTGCCAAGCGATTCGTGGAGTACCTTCTCACGTGCTTCGAGCATCGC
TCCAAGCTGGTCCGTCAAGCTGTACTAGAATCGATTGCCCACCAACCTCGACTTCTAGATGCAATGATCGACCCAGCGAGAGATGGACTTACTGGACTAA
TAGAGCGATTGGAGGGTTACATGACGGCGGCTGAAGAAAGTAACGATGATAACGAGATCGCAGAGATGATGTTGGCAGCGGGCTCTATTGGCTGTGAATG
TGACCCGCACCAACGTGATCGTGGGGATAATTGCACGTGGATTCTTTTACGACTGGTATCTCTATGGAATCGGTTCATGTTTTCGAAACGTTCGCGATGC
GCAGTGATGGCTTACTCCCAGATTTGCCGTATCACAATGCACCACGGCTTGTCGTGGAGACGGTTGTGTGTAGATTTTCCTGAACTGCTCTACTTTCCCC
TTATCGATGGACTATTGGAAACTCGAAGTCTTACGCTGTTTCTCCGTACTTTTATGGGCGGGAAAGTTGATATTAAATTTTTCTTGAAAGCGAGTGCGCC
GTACGTTCTTCCGAAGTACGTTGTTCATCAAAATGAGCATATGCTGCATGCGTTTGTGGCCGAGTTTAACGGGACAGAAGAAGATATTGTAATGGCTGGC
GATGGCGCGGATGAAGCACTGCAGATGAATGTCACTAATCTCCTCTTGAACCATCTCGACTACGTGTTGAGAGATTTGCTTATCCATCAAGTGCAAGCAG
TCTCGAATGAAAACCGGTTGGCGGAATGGGAGTTTTTACTCAAGTTCTTGCCAGAGAACTCGACAGTCCGTGATGTGATTGTACACTCCTCGCTGCGACT
AATGAACTTACTCGCGTGGGAGCTTGGTGGGCCTCAATCTCGTATGGCCAAACGTGCTATGCGAGAGGTTGCAAATTGCTTGAATGAGGATGCAGGGGAA
GCAGAAACCATCGAACAGGTAGCGAGTCTTCAGCCTGGAGAAGGATGCATGCCCCGACAGTTTTTTCTGGCGCTCATGACGGATCTAGGCAATCGAATCA
GCGGCAAAAACTCGTCAGCTATGAAAATTCGTGCGATCAAAAGCATTGAGTGCTTGCTTGATCTTTACGGTGGCTCCTCTGCCGACACGCAAAACAGTGG
GGTCGTGGATCCATTTGTTCCAAAAGTGATGGCAACTCTAAAAGTTGGTCTGACGGAGCATGGGTTGCAAGAGCATGCCATTCAAGCGTGGGGAAATTTT
CTACAGATGCTGTCGACGAAGGCTTTGGAAGCGAACCTGAGCTCTATAGTTGTCAGCTTGCTCTCATGCCTCGGCCACGAGTCCTCGGCAATTTTAATTG
AAGATGCATCGATTACTGGTAGTCAATGTTGGAATGTCGAGTCGTTGGAGAATTTTAGGCAGGATGGAACTGGGCGAGTCGGCTCGCTAGGTAGCCGGGA
TGAAGCTCAGATGAAATGTATGACAGCGGCGGTGGGTATTTTACGCTATCTGTTTATTGACAAAGGAGCTGAACTGAAGCCTTCTTTCCCGAAGATCCCG
TTGTTGCCGTCTATTCCAGAACTTGATGAGATTTACGCTGTTCTCTACGAAGAAGATGGAGATCCAAGATGCCGGCCTTTACGAGAATATTTGATGAACC
TATCGGCGTATGTCAATCATCTTGACGTAGCGGTTCGTGAAATGGCACTAACGCAGCTGCTGCGTTGTTTGGTTGTACGGGGTGCGGAGTTAGAGACGCT
TATGCAGAATGAAGGAGATATCTTCATCGACCAAGCGCTTGCTAGCGTAGTCCAGTCAATTCTGCAACTTTCTCGCTCGGAATGCCACGAGCCTATCAAG
CTGCTATGCGCTCGATGTTTGGGTGCTCTGGGTGCAATTGATGGCGCCCGTGTGCCTTTACACATGTTCTACACATCTGGCCCCCAAGGAGGTGCTGCAG
TCGCGAAGGAGAAACAGTATCAAAAGATCGAGTACTCAACGAAGGATCTAGCTATTGTACTGATCGAGAAATGGCTGGTTAAAGAATTGCGTGCAGCACC
CGAGAACACGGACTCGCTAGCATTTGCTATCCAGGAATTGCTGAAGTTTCTGGCAGAGTTGACAGCTGATCCGCAGCATAGCGGCCAAAGTCTGTCAACG
AATAATTTTGGGTCATCGTACAAGTCAAGACAAGATTCCAGCACCCCCATGCCTGACTGGATGAAAAGACGATTTGATCGAAAAGATGTTCTCCAGTTCG
TAGAACCTTATTGGTCAACAAACTACGCCGTGTTGGGCGGTAGATCTTCGCATCGCAATGGTAGCAGTGGCTCTGATCATCGATCATCGGCAAGCACTGA
TCAGAATCTGAATCCGGTGCGTGATGATATTTCGTTTTATGAAATGTACGGGACGTCATATGAAGACTGGATTCTAAATTGGTGTCGACGATTAATTAGC
CTTTCTCAGCCACCTGAGCGGAAGATCTTCTTGGCATGCAGAACGGCGCTTCCAACGTGTCCTCAGATATCTCGATTTGTACTTCCTTATCTGATTCAAA
ATGTACTTCGGTCGGGGAGACCTGAAGTTGGTAAAGAGCTTAAGAAAGAGGTCATGGCTGTTTTAGATGATCAGGACTGCGGTGTTTTGGTGGATGATGT
TCTAATGGCTCCTCCTGAATCCGAGCACACGAATGACTCAGTAACTAGTACTGGTGGTGCATCTGACAGAGGTGTTGGTGAATTTTTTCGACGTCATGAT
CAATGCTCCCAAACCATTTTCTCGACTTTTGATGAGCTGAACGAGTGGATTTGGACTAGCGAGAAGAAACGGCTCGCTCTAAGCGCCAGTGCTGCCAGTC
GCCAAACGTCTGCGTCTGGGCGCAGCGATGTGGCCTCAGACATCGACGATGACCGCGAAAAGGAATTTCTGGAAGAGTTTGTAAAAGGCATCCCCAGCCG
GTCATTGTCGAATGCTGCGTACCAAATTAAAGCGTATGCCCGAGCAGTTCAGTACTTTGAAGTTCATCTACGACAGGAAGAGTTTAACGAGACGGAGCCA
CGAAGCACTGGTGTCGAGGTGGCTGGCCCGATCCGTCTTTCACTGGTCTCGAAGAATGCCACTTATCTCCAACAGCTCTACAAAAGTGTGGACGAACCGG
ACTCGTTAGTAGGTTTAGCCTCATTGCGTCGCTTGCACGATGCACATCGGCACAACGATGTCGGAACCGACATGAATGACGAGGCTCAGGAAGAGGGGCT
GACTCTCACTGACTTGATGCATGAGATCGTCGACCACGAACAGCTTGCTCAATGGGAAGACGCACTGGCTTGCTATGAACAAGCAATTCAAGAAATCCAG
TCCGCATTGTCATTTAAATCGCTACCTCCGACCAGGCCGCTTTATAGTCAACTCGCAATGATGCAACCACCTGCCCAAATTCTGGATGCGGAAAACGCAC
ACAAAGATCCAGATATGATAAAGCCCGAGCTATATGGAGGAATGATTGGTTGCTTGATCCAACTCGGGCGTCTTGAAAGTGCCTTGCAGCATATCAACGG
CATCGTGACGCAAGAACCTCAATTCATGGCGACAATGTATCCGTATGCTCTCGAGTGCTCGTGGCGCTTGTCGCGTTGGGAGTTGCTGACCGATCTGCTG
AGTACTGAAAAGCAAAACCCGCTACTTCATTTATCAGGAAGCTCAGTTCATGACACTGCGAGTACTCGACTGAAGGGCTTTGACGTTTCGCAGTTGATGC
TGGTTCGTGTACTGCATAGCTTACATGGTGGTCAACAAGAAGAATTTCAGCGTCACTTGAAGGCCGCGCGATTAGAAGTGATGGGACCGCTGGCTGCGGC
GTCGGCTGAGTCTTACCAGCGCGCGTATCCTCTGCTACATGATCTCCACTTTCTACACGAGGCAGAGCAAGGGTTTATTTTCTTGCAGAATGCGAAGGAG
AGCGACGACCTCAGTCGACGCAGTTTACTCTGGAAAAAGCAGACTCCTTGGAATATACGGTATGATGCGATGGCAACGCAGCTCAAATACCGTGACCCGA
TACTCGCGCTACGTCGAGTAATCTTGCACGAGGCAGGGCTTCGAAATGAAGTATCGGAGAACTGGTTGGTGTACGCCAAGCTAACCAGAAAAGAAGGGTT
CATTCGTACTGCTACCAGTGCAGTGATGCATGCCCAAGCAATGAACAATCAGTATGTTTCGATCGAGAAGGCCAAACTGCTGGTGAGTCAAGACCGAATG
TACGAGGCGTTGCAAGTTCTCGAACCAGTTGACATCGATGCGTCTACGTTGGATTATGACGTTGAGGACCCGCACTTGTGCGCCAAGAACCTGCTCTTAG
CGACCAACTGGATGCAGAAATCAGGTCAACGTCAAGGGAAGAAGGTGATCGAGCGATATCAAGCTGTTATTCGCTTTGATCCAAAGTGGGAGAAAGGCTA
TTTCTTCCTGGCGAAGTACTACGAGTATCTGCTGAATATGAGCCACCCCGACGCGCTTAACGGATCCATGAGTAGTGATGAAGCGGCTGATCTGCTGCTT
GATTCGGTGTTTCACGGCTACTTGATCAGCTTGATGAAGAATTACGTTCAAGCGCTCGCACACGGGACAAAGTTCGTGTTTCAGTCTCTTCCACGATTAT
TGACGCTGTGGTTCGACTTGAGCGAAGTACTGTACGGAAGCAGCAGTGGGCGGTCGAGCAACAAAGCGAACAAGGCAACGAGGCAGATCGAGATCGGGCT
GAGTCAGTCCACCAACGAGCACAAGGTTCTCACTGGCATTACTCAAGTTGTGGATGAAGCCATTGAATCTTTGCCGGCGTATGAGTGGCTAGTGTGCTTT
CCACAAGTAACATCGCGCATTTGTCACCCCAATCCAGATGTAGTCGACAGTGTCAAGAGGATCATGGTTCAAGTGCTCCTGGCTTATCCAACGCAGGCTA
TGTGGTCGCTGCTAGGACTCTCGCGTTCGTTGAACTCACAGCGGAAGAATCGTGCGCGTGAGATCATCTCAAGTGCACAAAAGCAATTTCTGCACCAAGG
CTTAAGAGAGATTGCCGATAGCTTCTCTGAGGGCATGAAAATGGCAGAGGAACTCATCAGTCTTGCAGCCCACGACCCTGGCAACAGTAAACGTAAGATC
CACATCAGACTGAGCCGAATCCGGACCAGAATTCTCGTTCCAATCCAGGCGGCGCTGACCACGATCCTGCCGACATCTGGACTAGCCCCTCGCGATGAGC
ATCACGTTGCTTTCTCATCGAACGCACAGGTCTACATCAAAGCTTTCAGTGACAAGGCAGATGTTATGATGACCAAGGAGAAACCCAAGCGCATTGAAGT
TCTGGGCACCGATGGGCAGCTGTACCCGTTCTTATGCAAGCGAGAAAAGAACGGTGATCTCCGCAAGGACGCGCGTATGATGGAGTTTAACTCGATGATC
AACAGGCTCCTTCAGAAAGATCGAGAAGGTCGCAAACGTAAATTGCGGCTGCGTACATACGCCGTCGTGTGCTTGAATGAAGAGAGCGGACTCATGGAGT
GGGTGCGACACACGAGGGCGATGCGGCAGCTCATCGGCCAGATCCACAAGACTGAGCGCGGGTATATCCAGCCTGTTCGACTTACGCATGAGATCAAAGA
GCAGTACCTCCATATGCAGAAGAAATACGCGAATAACCCTGCTGCGATGGCGCGGTTCTACTGCCGAGAAGTGCTGTCGATGCCGGTATTCACGCCGAGG
TTTCACCAGTGGTTTTACAACAATTTCGCCGATCCGACTGCATGGTTCGAGGCTCGACTCATGTTCTCGCGGTCAGCAGCTGTGTGGTCTATGGTGGGGC
ACATCGTTGGACTTGGAGATCGTCACGGGGAGAATATTCTGATCGACTGCACCAACGGCGAGTGCGTGCACGTGGATTTTGACTGTTTATTCGACAAAGG
TCTGAAGCTGACAAAGCCAGAGATTGTGCCATTTCGGTTGACTCCCAACATCATTGACGCCTTCGGGATCACAGGGTACGAAGGTGTCTTCCGTCGCGTG
AGTGAGGTGACGATGCGGTTGCTGCGAGAGAACAAGGCGACGCTGCGCAGTGTGCTGGAATCTTTTATTCATGATCCACTCGTGGAGTGGGGTCGTCGTG
GTAAAACTACACAGAGCGACGCTGTCTCCAGCAAAACTGCGGCTGAACTCTCCAGTGAGCGTAGTAAACAGGAGACACGTCTTGTCCTCAGGGCCATTGA
CGATCGGTTGCGAGGCATCTACAACCTCGGCGATGCCATCCGCCCGCTTGTGTCGTCATCACACCGCAACATCCTACCGGAGAACGAAACGCTGCCATTA
TCAGTGCAAGGCCAAGTCGACAAGCTCATCGACGAGGCCACATCGAACGAAAACCTCGCCCAAATGTACATCGGGTGGATGCCGTTCCTCTAAAGCCACT
TCAACTTGGTGCAGTAAAAACGTTAAAAACAAGTCATTCGGTTTTAATCACAGGTTTGACTCGTTAAAAACAAAATGACATTTTACCCGTAAAAATTGAA
TTGAGCAACGATGGAGGTGATCGCAGTCGGTACCGCCGCCATCGACGTGGTTCACGAAGTGGCCGCGTACCCTGCAGGTTCGCTTAATCATTTAAAGTAA
AATGGCAAGAGCTTTTTGAGCTCACTTTATCGTGTACAGAGGACACCAAGGCGCGATCATTGGCAGCGTACAAGTGCAGAGGCGGAAATGCCGCCAGTGC
CCTGGTACGCGTACCTAGCATAATCGACGAAAAAACTCATGTCGACATGCACAGGTCGTTTGCTCACAACTGGGTGGTCGTTGTCGGTGGCTGAGTACGT
CGACTGACCCAGAAAAGGATAATGACGCTGCGTTCATCCATGCAGACCTCGCTGCATTCAACGTGGACTGCTCGTTGGCTGTCATTGAGAAGGAAGGCAG
CATGCCCGTGTCGGTAAGCTCCAATGGGTGGAAACATGTTAATACGCTATACGCTTACGTGGTTCATTTGAGTGTCTGGCAGTATATTGTTGCAAGTCGA
GAAACAGGCTCGAGGACGATTGTGCATCCCGGACGATTGCGGAATTGAGTTGTGACGCATTCGCAGCACAAGTTGGACGATACTTGAAGCAGGTTCGACA
AGATGTGATTGCGCCCGTGTGGTTTCACTTCGAAGGACGAAACATGGAGACCGTGAGAAACATGATGCTCCACATTCGAGAACATGTGCCCCAAGCGAAG
ATTTCGGTCGAGATTGAGTTCCCAAGATATCCCTGGAGTCTTGCGAAGACGTAGGATCGGCATGTATTATTGCATAAGCTAGTTCTTGCTTAAGCTGATC
GCTTTTATTTGTGATGCGTGCGTAGACTGGCGTCATTTGCAGATTATGTGTTCATGTCCAAGGATTATCTTCGCGACAACATCCAAATTTCCACTGCTGG
AGAATTTTTCGAAGGGATTCAGGAAAAACAATGGGGCGAGGACTGGAGTCGATGGGTGAGAGCGTTTATCTGCCCTTGGGGAGCGGACGGCGTGTACTAT
CTCGATATGACCGACTCAGCGACGCATCATATCCCCACTACTCAACTTGATCACGTGGTGGAATCCAACGGAGCGGGGGATTCTTTTATCGGAGCTACTC
TTGCTGCCTTGTCTCGTGACAATGTTCCGCTTCACCTCGCTTTGACAATAGCGTGCGATGTAGCGACTGTAAAATGCTCACAGCACGAGTTCAAGCTCCC
CGCCGACAAACTTTTGAGATGGAAGCAGGATCTACAATTCTCAAAAGGTTCCGACAACTTAAGTGGTGCCTAAATAGCTGTGTAATGCTAGACAAGGTTG
GAAGAAGTTAACTGTTGTGTGTTGAATTTTGTCCATGAAGCTGAGGCTGGAACAAGCTACATAGTGCAAGACTGCAATGAGCAAATTAGTGCTGGCTCAG
CTTCGACGTCGACATCACATGTCGTGAGCTCTGAAGTGGGGTTGGAACTGCAACGAGTAGAGCACCTTACTCGACCAGATACAGACGTATTCGCTGTGCC
CCTTTTGCCAACGATTGTGGAAGACAACGATGGAGATATCATTGTGCCTCGACGTCAAGTAAGCAAGCGTCGAAGGTCTAGTAGGACGATGCCAGCTTCA
GATAAAACCTCAGCTGGATCATGGGAACATGCTAATCGAGGCACGGACACAACCTTCATTTTGGAAGCGCGTAGTCGTACAACATGGGACACTGCAGGCA
CACAGCTATGGCGAGCGGCATTTCTACTGGCCGATTTCATGTACAGTGCATCGGTACGTCGATCAACGTTGCTGCTTCATCTTCATCAGTCTCACAAGTC
TACTGTCTATCTCTACATGCAGGGAATGTTTGCTGGCCAAAATGTTCTCGAACTTGGATGTGGAATCGGTACGGCCTTGCCTCCTTCGACATTTCGAGTT
GCAATGCAGAGATTTTGATTTGTGTGGCTTGATGCAATAGGCTTCGCATCGATTGTGGCTTCCCGACTGAGTCGCTGTGTATACGCGACTGACTCGGACA
AGGACGCTCTAGTCTTAACCCAGAGGAATGTCGAGCGCAATCTTCATGTATGAAACATTATGCGAATCAAATCCAATGATAATGGCTAAAACTTTTACTA
CTGTGGCATGCAGAGAGACATCCGACCTCGCTTGTTGAACTGGGACGATAGCAGGTTGATATCAATCGCTGAAAAACCCTCTACGACTGGGTTCGACTGG
CTTTCCACCGACCGAGCCGAGTTGGGAGACTTAGCGATCATCATCGCCAGGTAGGCCACGAGTCCATGCGTACCTGGACTTTTTGCTCACTTTTCTTCTG
TGTATGAATGGACCGTGATAGCGACGTCTTCTATGATGATATCACTACTCTCCACTTCTTGCGTGCTCTACGCCGCCTGATGCTGCAGTGTAATCGAGCA
AAAGCTTTCGTAGCGACAGAGCGGCGATCCGTTTTTTC