Description :
From Genome Similarity Track
Location :
Scaffold_94:23172- 29906
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_94-fgenesh-gene-0.8Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_94-snap-gene-0.1260S ribosomal protein L35
Pytiw_DAOMBR242034maker-piw_contig_94-snap-gene-0.19Rad51 DNA recombinase 2
Pytiw_DAOMBR242034maker-piw_contig_94-fgenesh-gene-0.4YneE

Sequence
6734 bases(100 bases per row)
GTATTGCACCTGGACGATCGCAACGAGCGCGAGCAGGGTCACGACCACGAGAGCGACGAAGAAGTGGGCTAATAACACGAGTGGAGAGTAAGATCAGTGA
GTTGTTAGTACTAGGCAATAATTTTCAGGTTGTAACCAGCCTCAGCAGCGCGAGTCGTACATTGGTAGAACGGCGGGACTGGAGATGCCATGGAGATGAT
AAATAATAATGATACAACATTGCCGGATCAAAATGTTAGTGATATAGCGAATGAATATTCTCATTGCAGTATTGAGAGGCCGCACCTCTGACGAAGAGCT
GCTGCGGGGCGTACGCGAGCATCGCAGCGTGCTGGTGGTTCGCTGAGCTCGGCAACGACGCCATGAGCACGAATCGGTACTCGCCGCTCGATCGGAAATG
GTCGGCGAAGAGGTCGTCGAGCTTCACACTGTGGTGCGAGTCGTTTGGGGAGAATTTGACGAGCTTTGGGAGCTGGTATTGGACACTGGATCGCTGACGG
ATGCAGTATGGCAGCGCGAGCTGCGCTGAGGAGCTAGTCTTCGCAACGTCAGCAGCTACAGAGTTGATCGTGTGGTTGGGCGTGAGCTTCTCGGCGTAGA
GAAAGTAATCACAGGCTTCACAGGCTCGCAGCTCGCCTGCCAGCGTATCATCGTTCACTGCGTCGTGAGCATGGTCCCAAATCGAAGGCGATTCAAAGCC
GAGCGTGGTCGCTTCGTACGAGAACGATACGTTGAACGGCGACTGGCTGGGCGTGTCGTCGTCAGGCGCCACGAAGGACTTTTCAAAGCCACCAGAGGAC
TTGGTGGAGCGCAAGAGCACGATCGACTCGACGGGCGTTTCGACGTCTGCTCGAAGCAGAAAACCTTTGACGCTGGTGGGGTCTTCGAAGAGCGCGATGG
GGAACTGTGGGTCGTAGTGCGGACAGAGGTTTACCTGCTGCTGCTGGGCCTCGCTCGCGTGGGAGATCGTGACGCACTGGTAGCTCGCGGTCGAGAAGCG
ACTCGCGCGGTCGCTCTTGCGCACGATGAAGGACTGGAGGCGACCCGCGCAGTTGCTGAGCTCCAGGCCGATAGCGAACGGCGCAGTCTCCGTAATGTTG
TTGATGGTAGTGCTCGCTGGTGATGGGAAGAGCAGGTCGTGGATTGGCTCGAGCGGCAGGAACACGGTCTCGCCCTTGCGCAAGCGGATCGTGAACGGCT
CGTCGAGCTTGAAGTGGGCGCCGTACTCGTACACGCGGTCGATCACTGGTGCAACAGCGTCGACACCCCACACATTGGTTTCATCGCTGGCAGATGCCAT
GGTCGCAGAAGAAGAGATGGCGACGTTCCCCTCTTGGTGGTGCTTCTTCAGACCAACAGCTACAAAAGGAGCGAACGCCGCGTCCGCATCCTGATTGAAA
ACGCTGTGCGCATCACTCGGTTGGGCGATAGGAGCAGCGGACGCCATGCTCCAAGTGACTCGTAGCTTGTCAAAGTGGATCTCTTGATGATCTGGTTCGC
GTGCGTACTTATCCAACCCAGCCACAGCTACGGACTTAATGGACGTAACCAGGTTACCCTGTCTGTTGTAACCCATTTCCAATGCGGGACAGATGTGAAT
GTTGGAGGAATGTGGCGCATTCATGAACCCTATCCCTTGGTTTGATGCTCAAATCCCAAATCGATTGGTCAGGAGCGCGCTTTTTCAAGCGCGCTTAATC
TATTTAGAGAGGGGCTTGAGCTTATATAAACAGCAACTCGCTCGCGTTCCCTGATCCGACTTTTAAGCGCGCGCTCAGAAAGCTGAAGCTCTGGTGGCCA
GCGGGGAAGGTGTGAGGTGCGCCGAAGGTTGCGTGAGTGCGCGAGGGCGCTGTCACCAGCCAACCAGTCTTTTCGACCGCATTTCGCGCCGCGAATTACC
AAACGGGAAGTTAGAAGCTAACCAACGCCAAGAGAATCATGGGTAAGCGGCTCTGTGACGATTGAATGCGTGGCGCAATGGCGTCTGGGGGCGGAGACGC
GTGGACAAGAGCGAAGTGCGCGCGGACAGATATGCAGGAAAGGCGGGTGGATCGCCGGCGGGATCGCGTTTCCTGGTCCCCGACGAGTAGTTCAGTAGAT
CTCGCGTGTAATGCAGTGGCAACCATGCGCCTTCTTGCGAGAGCGAGTGTTCCTGAATGGCGGCAGACAGTTCGATTCCAGCGCAGTCAGCTCGTACACC
ATGTGTGTGTGGTTGATCACCTACGGTGCACAATCAGCGACTGGTGATTGGTGAGGAGTCGACTGCAAGCTGATCGACTTTAGGTCCGCCGTGCGTCGCG
ACAAACGTGTCCACTGGCAGCGAGCGTAGACAGCAAGTGATCGAGTACTGGTGCACTGCAGACGCGAATATCGGCGCGTGGAGCTTCCTGTACATGCGCA
GCACCCCAGACAGCAATTGTCCACCCCGGACGCCCGTCACCGTGATGATCTTCGTACGACTGGTGGTATGCGTGGTTGGCTAACGAACGTCTGCTCTTGT
TGCCTTCTTGCAGTTCAACAACTTAAGGCCCACGAACTTCGCACGCAGACCAAGACGGAGCTCCTCCGCCAGCTGGATGACTACCAGCAGGAGCTGGCGC
AGCTTCGTGTTGCCAAGGTCATTGGTGGTGCCGCCTCCAAGCTCGCCAAGATCAGCGTTGTCCGCAAGGCCATCGCGCGTACCTTGACCGTGTACAACCA
GAACCAGAAGGCTAAGCTCCGCGCCGCCCTCGGCTCGAAGAAGCACGTGCCGCTTGACCTTCGCCGCAAGAAGACCCGCGCCATCCGTCGCCAGCTCTCG
ACCCACGAGAAGAGCCTGAAGACGCTCAAGCAGCAGAAGAAGGAGGCGTACTTCCCAAAGCGTCGTTTCGCCCTCAAGGCGTAAGTTAGTAGTCTTGTGG
CATTCGCATGAATAACAACATCACTCTAAAGCTTCCCAATATTTGATCACGCGCGTTGCTCAGTATCCCACTTACTCCTGTCGGTCCACAACTTACGTAT
TGTTATCGATCTTCCAGCAGATCTCCGATCGATGTCTCGAACTCATCGTCATCTTCGTCATTCGAGTCGGAAACGAGCTCAAACACGTCGAACACGTCGT
TTTGGCTGCTCTGCAGACTCTCATCGCTTTTCTCACCATCGCCTTCATCCTCGTTGTCCGCAGTGCTCTTCTGCGTCGATCGGAATGTGCACGACGGCTC
GACCATCGGGAGTCCTGCGAGCGCCATGTCGCTCAGAAGATCGTCGTGAATGCCAAAGCTCTCGCTGTCAAAGCTGGCGACTTGCTCGTCCACAGAAGCA
TAGACACCAGATTCCTGTTTTCGCAGACAAACACGTTCAGTGTGTGTTTGCCAGAACGACCGAATCAAACACACACTGCAAGGACACTGACGTTGATGAC
GAATGGCTGCACCATGTAACCGGCAACTGGGCACTTGACGATGGAAATCACTCTGTGCTGAGGATACCTCTCCATTATAAGCTGACACACGCACACAAAA
CATGTGAGCTGCACAACCTCAACGCGAGCCCAGAACAGCATCACATCAGTTCACACTTACTCTGGTTGTGACGCAATGGGACCAAGTCTCTCCAAGTTGT
GGCTTCGTGTACATACTGGCACCACTCCCGGCAATAGATGCACGATTCGTGACGACAACGAATGCTTGATGCGTGTCTGCAAGCAGCCTGAGAGAGATCA
GATACCGCACATAGTTCTCTTAGCAACAACATCTTAAATTGAGAAGCGAGTTTTCGTGGCAAGCTTACTTGAAATCTCTCGTCAACTTCAGTATTTGATG
CTGACGCTGGGTTCGTGTTTGATCAGACTATTACATTCGTGGCATGGAGAGTTAGTATAAATAATGCAGCACATGCGCGTGATACTGTTGTTTCCATCCT
TCACCTTCAAAAACAAGCTGGCGATCGAGTCGATCACGATGAGCTTAACGTTCATCGAGTGCATGCTCTCTTCGAGTTCTCTCAGGCTGCATTTCACACA
CGACCCAATCAAAACCCAACTCAGTATATCACATCCAATTAACCATGAATACACGCCGATACGTACCTGGTGATAAATTTCCCCAACGTGTCAACTTTGA
CGATGCGAATGCGTCTCACGATGGCCTCTGTAATCGCGTCAACGTCTGCATCCTGGCGAGCATTTCGAAACCGCACACGCGCAGCAGCAATCTGAAACAG
TCTGAGAGAACAGACGTGCAGTTAGTTACCCCGTCATAAACGTTCATTCAGCATAATGGAGTTGTCATGATACCGTTTGGCGCTAAAGTTTTGCTCCGTG
TCGAAGTACAAGACGCTCGCATCCTGGTTCTCCATTGCACATAGCACGCTGAGAGTCATCGCGAGTTGACTCTTCCCGATTCCAGCGACACCAGCAAACT
AAAGAGATCACAAGACAGAAACAGCCACTCGCTCGTTTAGGCTCGTAGATAATGGAAGCCAAATAATAAACAATTACAGTAAAGCAACGCACCTCCGTGA
TGCCTCCGTGCTTGATTCCTCCGCAGAGCGCTTGATCTATTGCTGGCAACCCCGTGCGAAGGAACACGGGATGGTTCACGCTCTCCAGGAACATATCAAA
CGCCTATAGTGTGGTTATGTCAATAGAAATTACGTTGTCAGCAACAGACCACACACTCACGCTTCTCTCACAGTACACCGCTCCCATTTACCGTTCGGCT
CTGTGGCGCTAGTCGTATCGACAGCTTCTCGACCAGGTCCTGTAGTCACACAAGCAGACCACACATACACATGCCACTATAAGCATTTTGCTGCCCCAAG
GTGTTACATTCAAGCCCATTCAAACACACGAGCGAACCTCCACTTCGTGGACCGAGAGGTCGACGGCGTGCGCGACGTCCCATGTCGAGCGCAGCGCCAG
CTGGCGGAAGTGCCGCACGCCCGCCGCGCGGAAGCGCTGCTGCTGGCGCTCGTCCACGCCCTCCTTCGCCAGTGCGCGCTGCAGCATTTTTGACTTTGGC
GCATTCACGAGTTGAAGGTTGCACTTCAGATTACAGAAGCACTCCGATAAAGTACGACTAACAAAAATACTACCATACAGTCTGAAATGACTGTATATGC
TGTTGGATAGGTTTGACCTTGAAACGACGCGGGAATAATGACGAGGTGGGACCTGTGAATGGAATGGCTGCAGCGGTGGACAATGCGCAAAGTACATTTC
CTCCCAACGCAATAGACGCACCGATCCACAAACTGGCGATCGTCTTCATGCACTCATACAGCTCCTCATGCTAAGAGCTCACCGCCAGCACCTCCATCTC
GAGAGCGAGAGGGGCACAACAGCTGGCATACGATGGCAGCTGAAGACCCATTGGTATTCCCATACAATAGCATACAGTTCTTGATACTGGGCAGTTTCAA
GCTGCTGCTGTTCCAAACTGGATACTGGGACTCTCTCCCTATCGGATAGAATGCCTTCCGCTCTCATACAAGCTCACTCCAAGATCTTCCTCTTCATACA
AGCACAACCTATCACCAGCGAGGCCTGAGACGCGATGATCTACTACAACACGGAGGCCATGCGCGATGTGATCTTCCGCTGGCACGGCTCGGCGCTCAAC
GGACCGGCGCCCGTGCGCGCGTTCTTCATGGCGGTCTTTGCGCTCTGTGTGGCGGTCGCGAACGACTTCCACCCGTTTGTCGTGCCCACGCGCGAGAGCA
CGGCCTTTGTCGACACGCTCACGGTCTTCAACACTTTTCTGGGCCTCACAGTCTCCTTCCGCATGAACTCGGCCTTCCAGCAATGGCGCGCCGGCGTGCT
GGCTGTTGGCTCGCTCGCCGAGACGGCGCGCGCCATCGTCGCATCCGGCTGCGCCTTTGTGAGCACAACCGCTACCATCCCAGTGGCAACCCCAGCACCG
CTACCAGCTGAGCCTGATGGCAAACAACCTCAGCGCCGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCCTGGAGAAGTGCACATTCTTCACCGAGCTGCGCCGACTCGTGTTCTTG
TACATTGCGATCGTGTTCCACGACTTCCGCGGCCGCGACGGCATTGACAAAATGCGCGACTCGGGCATCCTGACCGAGAGCGAGTTTGACGAGATGTACG
CATGCGGCACGGAGGTGTCCAAGGAGGTCGCGGACAAGGAGTCGTTCCAAGCCGTAGTGCAGAGAACGCCGCACAGACTGCGCGCAACGATCGTCGAGCT
CTGGATGAAGCGCCTCGTCGAGGTCGCGGCCCAGCGCGGTCACCTGAGCCCCGTGAACGCCAACAACGTGCAACTCAAGATCGCGCAGCTGCCGACGCTC
TACACGACGGTCTTCAACATCGCGAACGTGCCCATCCCATTCAACTACTTCCAGTACCTCCACTTCTTGATCATCGCCTACATGATGCTCTATACAGTCG
TCATCGTGCCGCGCTCGGGCTACTATACGCCGCTCTGGGTCTTTGGCTGGGGCATGTTCCTCTTCACGGCCGACCAGGTCGCCATGGAGATCGAGTGTCC
GTTCGGCTTGGACGCGAACGATATCGACCTGGAG