Description :
From Genome Similarity Track
Location :
Scaffold_379:23172- 27725
Transcript NameFunction/comments
Phyta_totarag7757callose synthase, putative

Sequence
4553 bases(100 bases per row)
cttcgagctgctgcaaagcaAGTTCGGcttccagcgcagcagcgtggccaaCCAGAAGGAGAACATGGGCTGCTGGATCACCAACTACCAGATGCGCGTG
CGGTCCGACGCCCCCGAGGGAGCCGCCGAGAGCAACGACTTCGTCACAAGGACGGCGCTCACTCGCGTGCACAAGAAATTCTTCAAAAACTACCTCATGT
GGTGCAAATTTTTGCGTACACCGCCACGAGCCTCCGACccggagaaggagaacatGTCGcggatggagaaggagctggcgctgttcctgctgctgtgggg
GGAGGCAGGCAACCTACGCTTCATGCCGGAGTGCATCTGCTTCCTGTACCACAACATGGCCGTGAagctcgagttcctggacaCGCTGCCAGACGTGGAC
GAATGCTTCTACCTCAACGAGATCGTGCGCCCCGTGTACCACGTGATCGCCAAGATGCGGTCGGCCACTGCGCCGAAAGACAAGCGGCCATTGGACCACC
AAGATACCACGAactacgacgacgtgaacgagTTCTTCTGGACCGTGAAATGCCTCGAATGCGACGAGATGAACGTCGCCCAGATGCTGGAAGTGCACGA
CCCCAAGACgttcaaggagaagcgcAGCTTGTTCAACCCCGTGCTGGCGTTCTTCCGAGTCTGGTACTTCTTAGTCGTGGTGTTTCACGTCATGGTCGTC
ATCACGTACGTGTCGTACATGGCAGagggagacgacgacggcggcctgggcttcttcttccggaTCTTCGACAGTGGCCAGAACAAGATCCGAGCACATG
CGTTCTACACCATTTTCGTCACTGTCACGGGGCTGCTGGCCATGAAAGCGGCGATGCAGATCTGGCTCTTCGGCGTGAGACTCTACAAGGACATGTGGAT
GGCTGTGGGGGTCTTCTGTCGGTTGTTCTGGCACTCGCTGTTCTTTGGACTGTTCATGGCGGTCAACTTTTCACCGGACAAGTCGGCCTTGTTTGGGTCC
ATGAGCAGCATGTTGCCCGGTGGAGGCACCGCCGGAACGTACTTGTCCATGGGACTGGTGTACTTGGTGATTTACTGCATCCCGGTGCTCACAGCTGCGA
CGATTCGGGCGTTCTTCCCAAACGCCATTTGGGGCATTCGGATAGTCAATTCACTCGATGGTACGACTCGACAGTATGTGGGACGCTACACAGCGCAGCC
GTGGAAGGACTACTCGAGGTACTCCATGTCGTGGTACACTATTTTCTTCTGCAAGTTCCTGTTCGCGCTGCAATTCATGATCCGTCCACTGATGGCACCG
TCGATTGAGATCTACGATATTTCCATTGACGATGATGGCGTATTCCAGTCGGGTCACAACATCTTGTTCATCCTCGTGCTGTGGGCACCGATCTTCgttg
tgtacatgtacgacacTCAGATTTGGTTCATCCTATACCAGTCCATTGTCGGTCTGATTATGGGCAAGCGCATGCACCTTGGCCACTACGTTGGCCTGGC
CCAACTGAAGAAGGGAATGGCTGGAGCTCCGAAGCTGTttgacgagaaggtggtgtcGCTTaagaccaagaagccaaACCCGGATGCACTGACGCCTGTT
cctggcggtggtgacgccGGTGAGCTGCGGCACCGTGATGTTGTGCGCCTTCGTTTTGCAATCATTTGGAATCAAGTGGTTGATAATTTCCGCCTGAACG
ACCTGCTAGACGATCGTGAGACCGTTATCCTGCAGTACCGCATTCTGAACAAGGGTGAGCGTATCCAGGAAccgatcttcttgctggccgGAAAGCTGTC
AAAGGCCGTCGAAGTGGCAGCAAAATCGCGTTCTAACAAGTGGGACACTGCAACGCTGGTTAAGAATATCGCTACAGCGGATGCGCTGGAAGGCATGAAG
AATGGACTGGAGCTTATCCGCGATATCTTCtacttgctgcttggtgaggaggaagagaagggCGCTCTGAGCGTATTAGAATACATTTACTCGTCGCCGG
ACATCGTGAACCTGATTGACCTGACCTACTTGCCTCAGCTTGCTGACAACATGGTCGAGCTCCTCGCTGTGATTTTGGATATGCCGGAGGATATTTCGGC
GATTGACACCCTGGAGACTGCTTCAGAGGAGTTGCAAATGGAGCTGCACGTGCAAGTCGCTCAAGTCGTTGACCGTCTGCGTTCCATCGCCTTATCGCTC
GAGCtgatgctggacgacgacactgTGTCGCGTAAGCTGCACAACTGCCGCTTCTTGCAGGCCACGGCCGATCTTGAATTCCAGACCCAGCAGCTAATTT
ACCTGTACAAGGCTGATGCTGTGGCTGAAACAGGCCTGATCGCCGTTCACCCCCGCGAAGGACCTGCTACGCTGCCCCCGCGCTTTTCTCCGGAGGACTT
CATTTCCAGCTGCACgcgcttgttcttcttgcttcgCCTGGACGTTGCGAGCTCGCTTCCTCGTTGTGAGGATGCAAAGCGTCGGATGGGTTTCTTCCTG
CACTCGTTGTCGATGGAGATGCCGCGCGTAGACTCGATGGAGGCGATGCCTTCTTTCTCTGTTATGACTCCTTACTACTCTGAAACTGTGCTGTTCACGC
TGGATGAGCTTAACAACCCGGTTCACGCGAACCCGCTTTTTGCtgagctcgagaagaagcagaaagcTAAGGGTTGGACGGAGCTGACGATCATGAAATA
TCTGATCACGTTCCACGCTGAAGAGTGGAGCAACTTTCTGGAAAGAATGGGCGCTACATCGCTAGAGGAGGCACTTGAAATCAACTCGACGGAGGTGCGT
CTGTGGGCTTCAATGCGAGGCCAGACGCTAGCTCGTACTGTGCACGGTATGATGCTGTACGAAGACGCAATCCGTCTGCTGCGCTGGTTAGAAGTGTATT
CTCTCCGGGACATGAGTATTCAGgaaaagctggaggagatgaacCGCATCTCGGCTCTGAAGTTCTCTTACATCACGGGTTGCCAGATTTACTCCAAGCA
GGTTGCGAACGGCGATCCTCGCGCAGCCGATATCGACTATTTGATGAAAAAGTTCCCGAGCTGGCGCGTCAGCTTCGTGGATTCTATCACGGAAAAGGAC
GGCGACAAGGAAATTAATCGTTTTGACTGCGTACTTGTGAAGGCTGAAGGCGGCGAAATTGTCGAAGTCTACCGCTATGAGCTGCCTGGTAACCCGATTC
TTGGTGAGGGTAAACCCGAGAACCAAAATGTGGCGCTGCCCTTCACGCGCGGCGAGTACTTGCAGACGATCGATATGAACCAGGAACATTATCTTGAAGA
GTGCCTGAAGATACCTAACTTCCTGGCGACTGCTACGAGCACTGGCGAAGAAGTTACTGTTATCGGTATGAAAGAACACGTCTTCACTGGCCGTGCTTCG
TCTCTCGCACGTTTCATGACGCTTCAGGAGCTGGTGTTCGTGACGCTGACCCAGCGTGTGCTGGCCAAGCCACTTCGCTCGCGTATGCACTACGGTCACC
CTGATGTTTTCGAGAAGTCTTTCGTTGTCACGAGCGGTGGTGTGTCCAAGGCTAGTAAGGGTATCAACCTGTCGGAAGATGTCTTCAGTGGCTACAACGT
CACCCTTCGTGGCGGTTTGGTGTCACACATCGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGACGCTGAGTCAGATCAACGCATTCGAAGCAAAGCTG
TCCAATGGTTGCGCTGAAAGTTGTCTGAGTCGTGAGGGTCACCGCCTGACCAATTCGTTGGATTTCTCGCGCCTGAACTCCATGTTCTACGGTCACTTTG
GTTTCTACATTTGCAATGCCCTCACAGTGTTCTGCGTTTACGTGTACGCGTACTGCAAACTATACGTCGCGACCCACTCCGAGGTTGAACTCACGGCTAT
CATGAAAACGGGCAGCCTCGACTCGCTTGCCAGTGTGATGACTACGCAGTATCTTCTTCAGTTTGGTATGCTGACCACGCTGCCTTTGTTCGCGACCCTG
TTCGTGGAGTTTGGGTTCAAGCAAGCTTCTCTGAAGGTGGTTGAGCTAATCTCGACTCTCGGCATTGTGTTCTACGTGTTCTTGACGGGTACGAAGGCAC
ACTTCTATGATGTGGCACTGATTCGTGGTGGCTCCAAGTACCGAGGCACTGGCCGTGGTTTCTCGATCACGCGTGACCCGATGGTGAACTTCTTCAAGGA
GTACGGTGTTTCGCACTTCCGCAAGGCTGTCGAGCTGATCGGAGTGATGATTTTGTTCGGGATTTACGGATCATTCGACATCGGTTCTGATGCACTGGAC
GAGTACTGCGCGACAGCGGACTTTGATTGTGACAAGGATCCTGACCAGATCCCCGCAAACATCACGTCGCTGGCAGCCTTTAGCAACCAGTCGCAGAGCT
ACGGTATTGCATCGTTCGCTGTGCTGTTCCTCGGTGCGTGTTGGCTAATGGCTCCCTTCGTGTTTAACACGGATGGTCTAGTTCTTCAGAAATCAAAGGT
CGATATCGCGAATTGGTTCGCTTGGATGATGCGCTCTCGCCACAAGGACGATG