Description :
From Genome Similarity Track
Location :
contig_30:231717- 284121
Transcript NameFunction/comments
g5312.t1hypothetical protein
g5313.t1hypothetical protein PHYSODRAFT_533283
g5314.t1hypothetical protein PHYSODRAFT_533148
g5315.t1hypothetical protein PHYSODRAFT_533258
g5316.t1hypothetical protein PHYSODRAFT_533258
g5317.t1hypothetical protein
g5318.t1hypothetical protein
g5319.t1hypothetical protein
g5320.t1hypothetical protein
g5321.t1hypothetical protein PHYSODRAFT_320063
g5322.t1hypothetical protein PHYSODRAFT_356191
g5323.t1hypothetical protein PHYSODRAFT_532626
g5324.t1hypothetical protein PHYSODRAFT_566444
g5325.t1conserved hypothetical protein

Sequence
52404 bases(100 bases per row)
ACTCTTACATCCTTATCAACACCTAACTTACATTTAGAATCGCATCAAGCTGTAGACTGCCACCTTGAGATGACTGAGGGACCCACAACAACAATGAACC
ACCTCCTGTGCCAGGAAGCCCCAAAAAACCCGGACGCCACCGATCCAGATACAACGTTTTACCTCCCAAAGCCGTAACATTCGAGACCCAGGTTGCAGTT
TCACCGGCTCGGACATCAACTTCATCGATTTTGTTGCCGCCAGATATGATGTTGACAGTCACGTCCTTCGTATCTTCACTCTTGAAGTTAATATTCACAC
TTCCATCGCCAACTTTCGTCCACGTGCCGTCGCTGTTGTTGAAAGCACCCTGAACCATTTTCAGTGCTAGCGCTTTTTCCGCACTACCATCGTCGACCTC
GCCAATGAGCTGAGTAGGACCACATATTGGCTGGAAGTACTCGGAAAACGATCCAGCGACAGACCAATCGTCCCAAATCGCGTACATTCCAAGAGCCTTG
TCAGCGATTTTGAAAGCATACTCGCCAGCATGGAGAAAACTCCCGTTGCTGCTCGTTCCCGAACTGATGAGATCGTCCACAACACTCGCAAACGTTTTGC
GAAGAGTGTCACGTGTGGCGTACGCCGTCTTCTCGTCCGATTCCTCGATCAGCTCCCCATGCAGTTATTAGTTGCGATAGGAATGTCGTTGAGCACCAAG
TTCGACTTGCTCATAGCTACACGAATATCATCTTCGGACATTTCCGGATTCTGTTTTCGATATTCAGCCACAGTCATCCATGTGCGATCCAGCAAGCGCT
TCATGTCGTAACCACACGTGGAGTTGGATTCCATCGCTGATTCCAAAGAAGTAATGTCACTTTTGCTCAGCGAGCTGAGGGTCTCGCCTAGCGTGATATT
CTTCATGAACGATGTGAACTTGCCCCAACTGGAGATGATGGTGGCGCCGTTAGCTATCACTTCTTTCAGAACGTACTCAGCAGTCATCATCACACTGTCG
ACGAACTTGACGTCATCCGACACGGAGTTTCCAATGCAATAGGCGACCGCGATTGGGATATCAATAACGACATTGTCCGTTTGGTACAACATCGTCAATA
TCTTGTCTTGCGAGGTTTGAGGGTCTGAGACTTGGAGAGCACGAACATATTTCGCCAAAGACTTTATCAAACCCATCGTGTACTTGGCGCACTTAATTGC
GACTTGCACAGCCCTTGCCAACACCGCGAACTTGCCGAACACATCGTACGAAATGAGAGATAGCGTTGTCTGAGCTAAGGCCGTAACCTTGGTGACGATT
TCGAGCGCGCAGTCGTCGTTCTGTCGGATGCATTCCATGCCGCATTCCACAGGGTACGCGTATGGACACTGAGCCCAACAAGTTCCTAGCTTGCCTTCGA
ATCCAAGCGGGCAAGTCTTCGCAATGTGGGCTTCTCGGTAGCACGCGTTGGCGATTGAAGTATCGAGAGCAGAACCGACCCAATTCGTGTAGGTAGACTT
GATCGTGCTGGTTGCTTTGATCACGCCGCCCATGGTGAGTGCAGCGTTCATGGTCCTGGAGATCAGTTCTGACTCTGCAGCTGCGTCGCTGACCCTGTCC
GTAGCCTCGTCCTGTGTGGAATCCCTGTCACTGCGGTCAGACTTACTCGAAAGCGCAGTGTGTGCGATGCTATCTATCGAGTCGCTGTCCTCACTGTCGG
TCGAATCGCTGTCTTCACTGTCCAATGAATAAAAGAGTCATCGTCGCTCCTTGATAGCCCAAACGAAGACACAGTCGCTTCCGGCGTCCCAATCGTTGCT
AAGGTGTCCGACGCGGCCACAGTAACGAGAGTGTCGGCGTTGGTGCTGAGTCAACAACTTTACTGAACGCGAATGCCTTTGCCGGAACCTGTGTGGACTC
GCCCCTGATTGCTGCGACGGCGACGAACATCACCATTGCCCTGAGTATCATGTTTGGGCACTCACGCGCGCCAAAGAGATCGCCGGGCGGCGTTTGTCTC
GAACACAGCAAAATGGGAAGTGAGCTGTTCGATTAGCGAGCCCGCTCTTCGAGCCGTGTCTCTTTTACGGGCACCGGCCGCGAGAATCGTGTTCATCTCT
GATGAAAGTCCTTCGCTGTGGGGGAATCACTATGGCTGTACGATTCCTACCGCAGGAAACCCTAGCTTTAAAAAAGTCAAATCTTCAAAATAGTCGCAGG
GCAGATCATCGGAAACCGGTTTGACACGGCGTTCAGTATATTGAACACGGCTTTCCCGCGCAGCCATCTGGCCGACTCAAAATATCGCCGAGTCGTACGA
GAGGGCTTGTCTCCGCCATTCGCTTGGTCGGATCGAATCTCCACTCTGCGAGAGAAACAGCATCTTGTGGCGTCGGGATAGGGACAAGGATAGGATGGAA
ATTCAGCCTGTTCTCAACAATCGAGAGGCACCGCCCCGTGTTGCACAGTAAATTTACGGACTGCATTCTGCAGCTCGAGACAACGCATGAACAGTGGTGA
TGTGAGTTGCTCAAGATTTTTGATAGGTGTGCGTCAAAGTCATTTGACTAATCAGCCTGAGTCAGCCAAGTGTGGAATGGGCTTTACGGAGCATCATTTG
TGCTGAATCACTCCGCTGGCGGCTCTCTGAGTCAGCTCAGGCAAATTTAATTTGTATCTTTGGCTGGTGACTCCGTCTTAGTAAAAATTGAGGCTCTACA
GCCCTATAAACAAAACTTAGCTTACATTGAGTATCACGTTGAGCTGCAACATGCCGCCTTGGGTAGACCCGAGGGACCCAAAGCAATAATGAGCCGCCTC
CTGTGCCAGGAAGGCCCAAGAAACCCGGACGCCACCGATCCAGATACAATGTCTTGCCTCCTAGCGCAGTCACGTTCGACGTCCACGTCACGGTCTCCCC
AGCTCCCACGTCCACTTCGTCGACCTTGTCACCACCAGACTTGACGTTCACGGTAACATCTTCAGTATCGACGCTCTTGAACGTGATGGTTACAGTGCCG
TCTCCAACCCTCGTCCACATTCCGTCACTGCTGTTAAAAGCGCCTTGAACGATCTTCATGCCGAGGGCTTTCATCGCGGTACCGTCGTCAATTTCACCGA
TGAGCTCTGTAGGACCGCAAATCGGCTGGAAATACTCGGAAACAACTGTGGATACGTACCACGGATCCCAAATTGCGTAGAATCCCATGGCTCTATCTGC
AACTTTGAAAGCGTACTTCTCGGCAGTCAGAAATGTGCCATTGTTGCTCGTTCCCGAGCTGATGAGATCGTCCACAACACTCGCAAATGTTTTGCGAAGC
GTGTCACGTGTTGCGTAGGCGGTTGCCTCGTCGGATTCTGCGATCAGCTCGCCCATGCAGTTGTTTGTCGCAATGGGGATATCGTTCAGCACAAGGTTCG
ACTGGCTCATGATCGCTCGAATGTCGTCTTCGGAGATATCCGGGTTTCGTCTGCGCAGCTCTGCCACGGTCATCCATGTGCGATCCAGCAAGCGCGTCAT
GTCGTATCCGCAAGTTGAATTCGACTCCAGCGCCGTTTTCATATTCGTAATGTCGGTCTGCTCGAGAGAAGCAATCGAATCTCCAAAGGTAATATTCTTC
ATGAAGGCCGCGAATTTGTCCCAACTTGAAACGATGGCCGCTCCATTGTATAGGACTTCCCTCAAAGCGTACTCTGCAGTCATCAATACACTATCTGCAA
ACTTGACATTATCGGATGCCTTTTTCCCGATGCAATAGGAAATTGCCACAGGGATGTCGATAATGACATTGTCAATCTGATAAAGAATCGCGAGGATCTT
GTCTTGCGAGGCTTGCGGGTCATGAACTTTGATATAGCGAATGTACTTGACTACGACTTCGTGAGGCTGATCATGTACTTGGTGCACTTGATAGCGAGTT
GAATCTTCTTTGGCCACTTGGTCATGTCGCCGTACATTCCCCATGAAGCCAGCGACAGCGCCGTTTGAACTACGACTGCAATCTTACCGAAAATTGCGAG
CCCACAGTCGTCGTTCTGCCGGATGCATTCCATACCGCACTCGATAGGGTACGAGTACGGGCACTGCGCCCAGCACGTCCCCAGTTTGCTCTCGAAACCG
AGCGGACACGTCTTGGCGATGCGAGCTTTGCGCCAACAAGCAGAAGAAGACAACGTGTCGAATGCAGAGCCAACCCAGTTGACATAAGTAGGTTCAATCG
TGCTAGTGGCATTCAGCACACTACCAAGCTTGAACGCCGCCATCCATGCTGCGGTTGGCGCTGCGGCGGACTCCATCTGTGAAGATGCAGTGTCGTCGCT
TTCCGCATCGTCACTGTCTTCAAAACTGTCGGCATCTCGATCGTAGGCTCTAGCTTCCAGCTTGACGGACAGCGCTGTCTGGCGAGACTGTCCGTGAAGT
CTTCGACGCTGTCTTTTAAGTCATCTTCAGTCAGGTTGAATGAATTCACAGCCGTGGCTTTCTCCGTCGCCGACTCATGATCTCCAGCGACCACCGTAGC
TAGGGACATCGGCATCGATGGATCGCGCTCGTCAAACGTGTATGCCTCGAGCAAGCGAATCCCGTTGAGCATCACTGAGAAGGCGGCGAGAAACAACGCA
ATCCTGGCCATGGCGTCTAAGCAAGAAACGTTCTTGAGCGAGTATGGCAAAATGAGGACTGAGATGGCAGTGAGGAACGCTTCACTGACGCATCGGAGTT
ACGAGTCCCAGGTTCTTGAGGCTCTCCTACTTGGCGGTCGTTCACGGATACCTTTGTCTGCCGCCGGATTAACGACCGCAATGTTCAAAGCCAAGGCGAT
CTGGCCATCGAGAGGCGCTGCTTCCAATCCAGAGTATTATTATTCGTCGGTAGGATTACCAAATGTCGTGCTTTTGAAGGGTGCGTGTGTCCTGCGCCAG
TCACTTGTCGGTCACCGTTTGAGACGTACAACCACCAGGATACGAACAGGGATTAGCACGCCCGTGTTGCTCAAACATGTCGATTAAATTCAACTGAGAC
CACCGCAAAACGGCAAGATACAGTTGAAGCTAGGGATGTGACGCGAAGGTACGCACTCTGGAATGTGACACGAAGGTGCATTTGTTTGAATGTGACACGA
AGGTGCCGAGCCACAAGCCACACAATATCCGCTACATAGAGGAAGCTCGCGATCGACATGGTGCTCCACGTGCTCGGCGCTCTCCGTGCGGCGGGGCGAC
GCGCCGCTACCGCCAGGTTCTTGGCCACTCGCAGCATATTGCAGAGCGCCACATTCGGCACGCAGGCCAGTGGTGCGTGACAGTTAACAACGCGAGATTT
TTTGGCACTTGCCTTTTCGCTGACATCACTATTTGTTTCTTATTTGCTGCCAACTATATATTTAGTGTACACGTGGGGAAATGGCACGCTGGGCCAATTA
GGTCATGGTGAGGTGGTCAAGTCGGGCATCCGCAGTGCGTACGAGGAGCTGACGCCCAAGCTGCTGGAAGCGTTCGAGGGCAAGGCCATTACTCACGTGG
AGTTCGGAGCTAGCCATAGTGCTGCCAGTATGTCAATTTGTGGTTTTCTTATTTGTTTGTTTGTTTTGGTGGTGCTGATCTAGTATTTGTGCCTTTGTGT
GCTTGTACTAGTTGACGAGGATGGCAAGCTGTTCGTGTGGGGATCTAACGAGTACAGTAAGCTAGGACTGGGAGAAACCAGCGAGATGGAGACGCTCCCG
CGTGAGGTGGAGGCTCTCAAGGGCATCAAAATCGTGGACGTCTCGTGCGGCGATTATTTTACGGCTGCAGTGGACGCGGACGGCAAAATGTACTCGTGGG
GCTGGGGAGGCTCCACCATGAAGGGTGCAGGTGGTCTCGGCCACGCTGGCGGCAAGGACGAGCCCACGCCGCGTCTGCTGACGACACTGGTGGACCAAGG
AGTGCCCATTTCCACGGTGGAGTGCGGTGAATTCCACACGGTGGCGCTCACCAAGGATGGCGAGATCTGGGCCTGGGTAACGGCGAGTACGGACGTCTGG
GCAACGGCGAGTCCGACACGTGCGAGGTACCAGAGCCTGTTGAGTTCTTCTCTAAGGACAACGTGCTTTCTATCGCTGCTGGTCGTGACTTCTCCTTCGC
GCTGACAGAGAAGGGCGAGCTGTACAGCTGGGGAGGCAACAGTCGTAAGTTGAAGCTATGGGGTTGGCGATCTTTGTGAGTGATGCTCAATTGCGTGTTG
TGATGCTACCACAGAGAACCAGCTGGGTATTGGCGGTGGTCTGGCCATGGATGTGTACAACATTGAGTCGATTCCGGTGCTGGTTGAGGCGTTCAACGGT
CTGTCTGTAAAGCAGATCGCTGCCGGCTACGACCACGCTGCCGCTGTGACGGAGGACGGACGTTTGTACATGTGGGGCGCTAAGATCTGGATCGAGCCGC
ACGAGATGACGGCCGTGAACGAGCACAAGATGGTGCAGGTGGCCTGCGGGCGGCAATACACCGTGGCACTCACGGATGACGGCAAGGTCTTACGTTTGGC
AAGGGTAGCTCCAACTGCCTGGGCCACGGTGACCGCAAGAACCAGCTGCAGCCTCTGCAGATCGAGGCTCTGGCTGACGTTAACATCACCTCGTACGTAG
CGGACCGTTTGCGGCGGTAAAGCGAATTGCAGAGCAGAAACTAACTGACCTCTATGCTGTGCAATGCAGGGTATCGTGCGGCGACTACCACATGGGCGCC
ATCGCGACACCCCATGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAAGTTGGCCAGTCGTAAGGGACAATAAATCGCGCGGTCAACCTGA
TGCTGTTTGCTTCACCTTGCTGTTTACCGAGGCTGGTTTGCTCGTTCGTGTAATCCAGGACTCCGCAAAGCGTCGCCGATCTTTCGAGTCCATTTTGCAG
TCCTACCGTTGTTGATGATTCGCGTGGTGTTAATGTGCGCGGCAATTCTGCCTTGGCTTCTGCTGTTCTCCGGGCTGTCCCTGCCACCGAACGATGAGTC
AAACTCAACTTGGCGGCAAAACGGCGTGTGGCTGTGTCGTTGCTGAATGGAGTATACGCATTCGAGTGGCGACAGGTTCCGCGGTGGTGGAAAGGAAAGC
GTCAGCTCACTCTCACACTGGACACGTGGCCCGAGCCGGAGATCGACATGGACGAGTGTGTGGCTCGCTACCAAGACTCCAAGCGCGACGAGGTCTGTGT
CATCAGCCGGTAGACAACTATGAGAAGGGGAAGGAGGGGTCAACCGACGTATCAAATTAGTAAATCTATCGTTCTATACTGCCTTGCAGTCTTCACTTGC
CGTCACGCTTCCGCTTGAGGTTGTTACGGCTCTGCATGACAGCGGAACCGGTGCCGTCTGCCGCCACAACATCCGTGACAACGTACGGAGCTTGGGCCGG
TTCGTGAGCGGATAACATGATGCTGGCGAGTGGCATGCTGCTACGGACCAGGAGGTTGACACGCTTTAGTACTGACAGCGGCAACGGACTCAGGACAAAC
AATCGACGCTTCTCGGCGTCCACGGCGCGGATGACCCCCACCCACACACGGTGCGTGCACTGGCTGCAGCACGATACGCGGGGGTCCTTCTGTGTCTTGC
TCGAACGGTTTGTAGTCAGGGTTGACGCAGAGACCCACGATGCAGGCGTTCAACGAGAACAGGAGCTGGCTCGGAGGCACAGAGGAGCTGGCGAAGGAGA
TGTCGACCTGGTCGAATGGCACCGCGAAGGGTGGGAGTTGAGAATACGCGCGGTAGATGTTGCTGTCCACGCGGTTCTTCTCCGAGAGCACTTGCAGGTT
CTGCAGCAGTGCGCGCGGGAGGTCGCAAGGAGTGCGGGCGAGGAAGTACGAGTGGAAGCGATACAGACGCATTTCCTTGGAGCTTCGTGGGGGTTGAGTG
ACGCCAACGGGATCCCAGGGAGGAACTCCGTGAACGCGCCACCGACCGTCCGTGGGGACATCAAACTGTTTGTTTTTCGTCGCGGCAACCAACTGCACGA
CGTGATCGGGGTTCGTCTCCTGAATGACGTTGCACAGCAGGTCGTGGCCCATGCTCTTGATCCATCCGTCCGTATTAATTACCAGCGGAACGCAAGCGCT
TTTCCGGGGACTCGAGTCGGCTCCGCTTCCCCACTTGCTTCATACAGACGCAGCAAGCTCTTGACCGCCTTCATGTAGTACAGCGGGTCGTTGCCCGGGT
TGGCGTTTCCGCAGAAGAACGACCGGACCGGATTCTTCATGTGCGAGAATCCTGGACCAAGCAGCGGCGTCGTCAAGGCGTGCAGCGCTACAAGGCCCGA
CGGCGTGAGCTCACTCTGCCCCAGATCCGTGTCCAGGAAAGCGACCGTGTCAAACTTGGCAAGCAGCCGGTTCACCAGATACCTGCAAAACGTGGACTTG
CCCACCCCCTTGCCGCCACAGACCACAATCTTCTGATACGCTGGAGTCGCTTCGTCCAGCAGACTCGACTGCAACCTGTCCGCAGTATCCTGCCACGCCT
CTGTGAAATGCAGCGTCCTGAACGAGTCCACCACGACCAGCTCAGCCAGAACACGCTCCGGCGACTTCCAGTCATGATGTAGCGGGTCCGTGTTAGGAGG
CGCCGCACTCGTACAGTCGAAGCCTGCAGTGATGTCGTTCAGTTCGTTCTGGTTGTGTTTGGCGACCATCATCTTGAAACCAGGCAGCACCGCCGCCGGT
TTCTCGGGTCTCGCGTTCTCATAGAAACTCGAGATATTGCCGAATGTGACGGGGATGGCTCGCAGCACCAGCACAATGGGGAAATCGTCCGCGAGCTGCA
TGGCCAGTCGGTCCGCCGCAATCTCCTCGTCCTCGCTCAGCGCTTCGGGTGGCAGGTTTGGCTCCATGGCCTGCAGTAAACTCACATTGACAGGTCCGAA
CGGCGCCTGCGTCTCCTCATTGCCCGAACCCCTCGATCACCAGCAGGTTGTTCCACTTGGTGAATGCAGCGAAAAGTAGACGCCCAATGGCGGCCGGAAG
CCCAGCACGTCCACGTTCCCCTGGAAGAGCCGGAAAAGCGTCATACCGGCGCAATTTACGCTCGAAAACCTCTGCATCCCCAGGGCAACCACATTGCCCG
AACGCACACAGAGCGCGCGGTACAGCGGTGAAGATGCCGACGCGCGGCCCCAGGACCGTAATGCGAGATGCTCGTCATTGCGACTGATGATTGGCCACGA
GCGATATGTGCGATTCTCACACGTCACATGTCCTTAAACGGAGGGTTTAGCTGCGTGCTGCTTCAACATGACAGACCAAAAAGTCTGTCCTCCATTCTGT
GAGCTCCAGTCTTGGAGAGTACCGCCAAGAAATAGGCCGGCGCTGACGAAATGCATCGCTGAGGTTTTGGACAAGAACACTTTCCGCCTATTCTCGGCAC
TGCGTCTCCATCCGTGCAGCCTCGTCCTGAAACCAGTCCGCAGGACGTGGAGTTTTTGGAGCGGTTGGTCTGATGCTAACAGCCAGCTTTTGACTTCCAG
CGTTCACTGGTCTCGTGCCGCGCTACAACCACAAAGCGCCGTCGAGAACTGCGAGCAACGAGCACGGCATGTTGCCGGCGCTCACGACAAAGCCCAAACA
GGCGGTGCGCCAAGTCAAAGGCCTGTCCAATGACTCGATCGATTCGTACTCGAACATGCCGCTCGGTGGGGGCGCGGGCATTGGCGCAACATACGTGGAT
AATACTGAATCGGGCAGTGGAACGGCCCGCGGGTCTCCGCCAGCGTCGAATAGGTCGACAATCAACTCTGGGCGTGCTTCTGTCGCTAAACCTTCAGCTA
ACGAGGAAGGTGCGACCTTGGCTCGTGTAGTGCGAGACCGAAAGGCTTCGGGTGAAGAGGAGCTGTCACTACGCACGGGAGATATCGTCAAAGTGCTGTC
CTCGAAACGCACCGGGTACCTCAAGTGCGAAGCAGGAGACGAAGTGGGCTACGTACCGTCGTCCTATCTGGAATTCCTGGACGAAGCGGAGAATGCGAAC
GGCACTGCAGCATCAGAGGAGACTCAGACGCGTGCCGCTGAAAAGCAGCGCAAGAAACAACAACGAAAGGAAAAACGAAAGAAAGAGAAGCGCGAGGTTA
ACGGTGCTAGTGACCCGGAAGAAGGAGCGCCAGTGTCTGCACGGTCTCCTCGTAAGGAAGTCCCTGCAGCAGAAGACGAAGGCAATGAATCGCCACGAAA
GAGTAAGAGAAGAATCGGAAGCATCGTCCGGATCGAGAGGACGACGACGCAGGACGAGCGGGAGCTTCCGGCGTCGATGAAGCTCCGACCAGTGCCAGAT
CTCGAGCAGCCCGAAGACACTGAACGGTCTCGTAGTAAAAGCAAACACCCAAGAAAAAGCGCCACCGCGATGCAGATAGCAGCGTGTCGAGTGGAAGTGA
CGCAGGAAAACGAGCTGCACGTCACGGACGCCGTCGTCGCCATCGACGCGGTTCAAGTGAAAGTGATTCGGGCTCGACGTCTTCTGATGATTCGGATGGG
AGCTACCGACGAAGACGACGCCGTCGCCGCCACAGACACCGACGTTCTAGTGAGGAGGAAGAAGAAGACGATAGCGACTACAAACGGCGTTCAAGACGGA
GCAAGAAGCGTCGTGATAAAGGCGGCGGTGAATCTGAGCCTGAAGAAGGGTCTCGGTCAGCTCGGAAGGCCGAGAAGAAGCTAGCTGCAGCCTTACAGGA
AGCAGAGAAAGGAGTGAGTCAGTTAGACGTGAGGTCCGATGAAAAGGCATCGGAGCCTGTGGAGGCGAAACGACTGCCTCATCGAACAAGAAGGAGGACC
GCGAGAGCGAGGGAAGAAGGAGGAGACGGAGCGGAGTGAAGGTTCGTCGGAAGGGCGGGCGACGAATGTTTCAACGGGACGTAAGGACGATGAAGGGCGT
GCCAGTAGCAGCGCTTCGTCTTCAAGCCAAAAGCAGAACGGTAACAGTAAGACTGGTCTCGGCAGGCAAATTGGCGACAAGATGCGCTCATTCCTGGTGG
TAGCAGAAGCAGCACACAGCAAGAGTTCAAGCGGCATTTTGAACGCATGTACAGGCACAGTTCAAGGCGAGGAAGGCTGGTACGAGCACGGCGAGAACGA
ACGCTACTATTTCGTGCTTGTAGATGGAAAATGGAGTCTTCTGTACGGACCCATGACTGAGGACGACTTCGAGGTATTTTCCAACCGGGTACGTTGCTTC
GTCCTTGAAAGCGTCCCCACTTTGTTTCTGACTTTTTGCTGTGTTTGTGTTGCTCGCTTGCAGTGCTGGAGCAAAGCCGCCATCGAGCTGCCACCGACGT
ATCTGCACAGTCAGGATACTATCTCAACCGCGAGCTGCGTGTGCAGAAGAGAAGTGAACAGCATAAAGTACAATCAGCGCTTCCTCCTCCTATCACCTTC
TATCGAATATATCATGCGAACGAAAGTTGCCAGTAAGCAATATGCATTATCCATTCATTAGAAAGTGTTGGCTAGCCTAGCAAACAAGCAATAGATGCAG
GGAAGCGCTTGGTATTCGAGTCCGTCGTTCTCTTACTTGGCTGCACCCGTGAGCGATGCGCTGGGAGTCTCCAGGACGACTTCCTTCGGGAAGTAGAGCT
CTGGTTTGATGGATTCCTCCTGGGGACCTGCACCCGTAAGCCACTGTGAGGGAGACCGCAGCAACTCCTTCAGCTCCTCACTTAGCGATAGCTTGCGTCG
TGGAGAAACAAGTTGAGTCGCCCTCTTGGGTTCGATCGACACTTTGAATTTCTCCGCCTTGTCACCGCTTGACGCTGAAAACGCCGCATTCGCAGCAACC
GCATTCCTCACGACCTTCCAGTTTGTGTGCTTCTCATGGGGCGATAATGGCTGCGCCACTCGCTTGGAATGGGACAACTCCTTCCACGTTGTATCATCCA
CGGACTGATTGGCGATGTCATCACCCGTATTCAGATCCAAACGCAGACTGGATGCCTCCTTACGCTGTCCAAGCCGAACTTCGTTCAGCTTGCGGTCCAC
AAAGGTTGCCTGCAACTCAGGAGCTACCCTCTGGGCAGAAGCTGCCACCATGTCTTCACTCAACTCCTCGGAGCCTGCCTTGCCTTCCGTATGGTAATTC
ATTTTTCCTAGCAGCTCTGGCGTGCGGGTAATGCTGAAAGTGCCCTCTCTGTGCATCTTCACAAGTTCCGTAAGATGCTGTTGCTGTGGTAGCCAATGCG
TTGCCACCTTGTGGTAAGCTTCGCGGTGACGCTCGTTCAGGCCATTGGGTACCACGCACACTTGTTCAAGCTTGTGCAGCAGTACGGGCGTCTCTTCCGA
GTGGAGCTTTCGGTTGTTCATGCAACGCTCTGCATGGGTAACCAGCTTCTCGAGTAACTCGAGGTTGGACTGGTATCGTTCCTCAAGTTTGGCTTGTGCC
TCCTGCTCGCGCTCTCGCAGTCTCGAGCACTTGTCACGCACCTCCCTTAGCAGCTTTTCCGTCTTCACCATGTCCATTTTATTAGCTGCTTCAAACAAGA
GCAGACGATCAAGCAGGATTTTCACGCCGACACCTTCTCCAAAAGCAGGATCGCACCATCCTAGTCCACGCTGTAGCCAGCGGTTCCGCAACGTGAAGGC
TGCAGATGCCATTCCAGTCTTTGCCGATGCGCAGCGCTTAGCTTCCGCTTGATGCTCAACGTCGATGTGTCGAATCCGAGCAGCCAGTCAGCAATGGACT
GGCTGAACGTCCAGCGGCTCCACTGCTTTGGGATCGCAACGCCGTCCACGCTGCTGCATTCGTCAAACGGGAAAGTGTCCTGCAATCGATTCTTTCCTAA
ATCAACACGCGAGCGGAAACTGGTTACCTCCTGGAACACGTTCGCAGCGTAACTGATGGCAGCGTAGTGCGCCATGGCATGCGCATTATCGCCCTGTGGG
CATCGAGCGAGCATTTCATCACTTGGGGTACGAATTCGACCAGCGCCAACTGCTTGTTTCAGCTCCTCTTTCGTGAACGCCTCAGCAGGTAGCCGATAGT
TCGCACCAATTACTCGCTGTTGATGTTGTGCAGCTCCATAGCTATTTCTTCCTTGGTCACGGTCTCATCTCGAGACTTACCGAGGAGAGCTCGCACACAG
CGATCCAGTGCTGCGTACGCAGCGAGCCTTTTAGTGTACGCTTCGTGCACTAGCAGCCGCTGAAACCGTTCCACGAGCGTCATATAGTCGCCGCTCACAT
CGACCTCGGCATTTTCAACTGCAGCAGCGAACATGTCGGCTTCAGTCCTCTCATCTTCATCATCAAGCACATGTGACTCGCCGGCAAACGTGCGCACCAG
CGAATTTCGCTTGCGCAATGCTTCAAAAAGCAATGTTTTACGAAGTATCTCGATTTGTGTGTCGATAATACCCAGCCCGGTATTTAACGCCTTCGAAGAA
GATGCTCCACTTGTGTTATCAGAGGCGGCACCTGTGGATTGCGTGCCAATACGAATCCCACGTAGTATCACAGGATCGCCTTTGCGGTCCATGCCTCGTT
CCTGGAGTAGTGTCTGAATTGCGGTCGTGTCCGGCGGCAGGAGAACTTCTTTTACTTGATGCCGGTGCATAAGTTGCAGTAACGTCGTGGGGTTCGCTGT
CGTCGGAACGGCTATGCCTTTTGCCACTAATACCTCCTTCTGCAACGTGAAGGCTAGTGATTTCACTAGATTCTCAACTTCTGTCGTTGGGATTTGCCGG
AGTGTCATCTCCTTCAGCAACAATTGGTAATTCTCAGGCACGGCTAGCTCGCGATTCCTGCTCACAGCATGATCAACTTTCCAGAGCAAATCACTTTTAC
CGAGACTCTTCATCGATTGGTAGAGCTCGGCTACGCGTTCCGGATTGGGTAGCGCGAATACTTGTTGGCTGTCATCGCGGTGCTTTTCAAGCATTTTCTC
AAGCTCCTCAATCTCTTTCAACACAGTTTTCGGCAGGGCAACCGATTGCGATCCGGATTTCGGATCTGCTAGAGACGGAGAAACCCACGCATCATCTGAA
TCGTTGCCTGTTGCATTCCTGTCAGCAGTCGGGTCAAAATTGGACGTTTTAGGAATCACACCGCGGTCTTCCAGAGCGAGACGAACATTCGCTGGAGTGA
ACACCATCTCTTGCTGTGTAATCAGTAGACGGATGTCTTTCCCGTCACGAGAGTAAGACAGCCAGTTTCTCTTTTCTGTATCCACGGTAATGCGGTGATA
GGGAATGCGCTCCAGTTCGTATTTTGCCTCCTCAATAGCGTACCATTCTGCCATACCTCAAGCTGTCCGTTGTCTTCGGCACCACTGTCAGACCTGATAC
TTCCATCGGATGATACCCGACTACTGGAATTTTGATGGGATAAGCTGCGTGGTCTGCCGCCAGCTTCATCCTTATTTTTCGGTGAAGGTGGTGCTGCTCT
GATCGGATTGAACAGTTTCTCAGGCTTGTTTAATTCGCCTTGCCGGTTGGCACGCATAGATCTCCACAAGTGCATCTTTTCAAGGATAAATGGTGTGTGC
TCACAGTCGATTGAGTGCTGCTGCTGCATCTCTACATCTCATGCAGCCACTCCTGAACTTGCTCCCATCGGTTCTGCACAGTGTTAAGTGCCCTAGCATC
CACGTCCGCAAAGCCCTCGCATTGCTCATCTAGAAGCAGCAACAGCTCGTGTGTGCGTCTCCAATGCAATCCTTTCTTTTCATTAGCCGCAGTTCGCTGA
GAGGACCATTCGGCTGCGTAATAGCCATCCAACGGGACTGGATATTCGAGACTGCATCGGCGTGGCGCGTACTGAGTCCTTTGCTGCAACGCTGCTCCAC
AATTTTAACAGCTGCGGTGCGCGAGTTCAGGTTGAGCTTGCGTTCCTGCATGCTCACGAGTTCTCTCAAAGCATTCAGCAATATTTGCCACTTTTGTTTC
ACCTGCTGCCATGCTGTGCTGAGTCCAACATCGAGGCCCTCGATCTCCCGTTCAATATCGTCCAGAAGTTCAGGTGTACGTTGCGCGTGAATCAGTGCGG
CGGCTTGAATAGTCATGAGTTCTCCAGTCTAGGTTGCATGTTAACCCAGCGTTTGTGTACTTTCATCACCGAATCTCGATAGGCATTTGCCACTTGTGCA
ACACTCTGCGTATATTCTAGCTCTTCAGCGTCAATAGCCTTTTTTTGACGTGGGTTGGCGAGCTCTCCTGCAATGCGAAAATATCCCAAACAAGGCTGAG
ATACCGGGGTGCGTTCCCAGTGTAGTTTACCCTGAGCCTGCTTCGTGAGCTCGTCCAGGTAGCCTTTAATCGTCAGCCAGCGTCGACGCTGGGCCGGCAC
TACTGCAGCATGGAGACGCCGTCGCGCTGCTTCATGCTGTGCAAGATACTTAGCTTTCCATATCTTGTACACATTTATGGCTTGCTCAAAGAACGAACTT
TCCGAAATCTTCAGATGGAGTCGTAAACGAACTTTGCCTCTGTCTTTTTCACCAGGACTGTGTGTAGCAATTCTGTAGCCGCGCAAATTAGTTGTTGGTA
AATACAGAAGTTGGTACATGTCGTCACGGGGCTGCTGATCAAGAAGATCCATCAGCGGTATACAAGCGGTGCCTAAATAGTTGTCGACGTTGTTACGGTC
TTCATCCATCACCTTCACGCGAACTGTGGCTCTCATGATCATGTCAAGTACCTGAGTTAGTTTTGCAAGTCGAAGCCGCTGGTACAGTCGCTGGCGAACC
TTCTGATCCTCCAACTCCAATTCGTCCACCTCGTTGTTGAAGAACGACAATAATTTTTCGCCCGTAGCGACATCGACTCGGTCTTCCTTGGCGTCCAAGA
TATACAACTCGTTCAGCTTCGGCATAAAGTGAACAATAAACACTTCGTACAGTTTTAGTACGGCGTGACGCACTCGATGAGTGCATGTTGCCACATTGGC
TTCCACAATCACCATGTTGTCGCGAAGCTGGCTATCATCTCGTCCCCATGGGCATCAGATGACCAGGGAAGCCTTCGGTCAATGAGCCCCAACTCCTGGG
CGGTGTCTTTTACAAGCGATTTCGTTTGTTGCAGGGTAAGTCGCAACTGGTCAAAAGCGAGAGAAGTCAAGTCAGTGCTAATTCTGTTGGACGCGTTTGG
AGTCGACACAACTGCTGTTGAGGATCCAGCAAGCGTTGTTGCATGCAGCTTGTTCATTGCGTCAAATATCAGCCGAACTTTGTGATTTTTTGTAGCTGAA
GCTCCATTTCAAGTGACTTCTCCAGCAGTATCTTCCCTCCACCAGAAACAGGAGGCCCAGTAGCTAGAAAACTACGAGAGAGCTTGTTCTCATGCTGCTC
AAGCGTCATTTTGAGCAGCTCCTTAGGGCAGATAGCCCAGAAATCCATGCTTTTTTCGAGTTGCTTGGCGTACACTTCGGTCTTTTCACCGTAACTTTTC
ATTCGCGTGATACTTAAAGAAATGGTTCCAACGACGCGCTTCCTATCAGATCCTTCGTGCTGCACGCTGAAAATCGGTTCATCTTTAGGCTTGTCAGCAT
TATTTGTTGAGCGAGAGACGCCGATTTTTGCCATTGGAATGGTGACGATTCCGATCTTTGTGTTCGTCTTCTTGTCCCGTACAATCATCTTCACATCAGA
AACACGATCCAAATCAATAGCAGGGTACGTAAACTTTAGCTGACTGTCCGGCTGGAGCGCATACTTATTCTTCCAAGCCACTGATGTCGTTAATGGCGTT
GACAGCGTTGTCCCTGCTGCCGTTTTGTCGTTTGTCAGTGAAAATACCGAGTTTTTCGGGTAAATCTGTTTGTCCGCATCCGGCAAAATTTCGCCTGTCG
AAGAGAGCGCCAAACCAAATGGTGTAGTAACCTTCTTGTCATTAGCCATGTGCTGCCGAAAGTCACTGGAAACGAGTAGCACTTCCACAAGCAGCCCGTC
AGTTCCCATCTTTTCTTTTAATGTCATGTTACTCGCTTCCAGAACTTGCACACTGAGCTTGTCGAACTTAATGTCAGCTCTCGGTACTTTCACAGCGGCA
GTATTAGGAGATTTGTTCGCGCTCGTCTTCTGGAACTGAAGGTTGCAGTGAGACGTGGCAAAAGGTCCAGGAGCAATGTAGGCTTTGTGGAATGGAGAGA
GTTCTCTGCGAACACGAGCTTCTGCCAATACATCGTACATGGGGAAATGCAGCTCGTGAACATTTTCGTCGAAATCACGAACACTAACACGGATGTCATC
AAGAGGTTCGAGTTCAAGTGAAACTTCAGGTTCAGAATCGAACCTACCCTCCGCACTAGTGAAGTCAACCGATAGCGCCATGCTGGGTGCTATCATTTCC
TCAGTAGCAGCCAGGAGCCACGGCAATTTGCCAAGATCTCCGAAATCTGTCAATGGTTTGTCTCCTTCCACGGCAAGTGTCTTTTTGAGCTTTAACCGTC
CCGAAATACCAGTGGCTTGTGCAAACGAAACATTCACCGCATCGCTGATATTCCCGTGGTCATTGTGAGGCATCGATAAACGGAACTTAATCTCGATGGT
GGCATTAGATAGCGCCACCCCGTCAAATCGGCATTATTGTCGCCTACTGATGTGTTGTCAGAAGGCGACGGCATCATGTTTACGACCACACTGCGACTGG
GAGTGTTGTTGAAGTCTACTTTCACAGCTTCGATCATTACAGTACGTCCTTTGCGATGAAGCTGAGGGTCGATGTTACACTCCGCACGCAGAAGTCGCTG
AAGGATGAACACAGCCGAGCCAGGAGTCTTTCCCAGCGTAGCCAAAACCAATGCCTTGAAGAGTGGGCCCGAATCGGAACACGAACTCACGGTGACAGCT
CCACGAACTTGCACGAGCGGCGGCGGCGCCAAAATAAGGTAGAAGCAGTTTTTCTTACTAAATGGTAGTGTGCCATTTGAGAGTGTGTTGTGCATGCGAC
GTTTACAAGCTGCGGTGTACACCAGCTCAAGCTTCTCTTCCTCTGCTTTGTCGAAATTATCTCCTTTCACAAATCCATGGTATTGGCCTAGGAAACGTGG
CTGGTCCTCGCTTCTCTCCACAAGAGCTGATTGAAGTAGCTTGTTTGTGGTCGCATCGCGCGCTTGAATAGTTTTCACAGCAGAAGGAAGCATTGCATAC
ACCTTAACAATTTTGTCACTACCCACCAAAGGTTGTTCAACTTATCAGCCATGGTCGTGGTTGAAGACGAAGGCTGGGTTCCTGTTTTATCCAACGTCTG
CAGACTAGAGCTGAAAACGGACCCCAGCAATGCCGTGTCAGCCGCAATAAATTTCTGGCGTGTACGCAACTGAGATCGCTCCAAATTATCGACCAACTCG
CCACTCTCGAGCAATGTGCTGTACTTCGCTGTAGAAGGAGAGTCATCGATTCGACTAGTTGGGTGATAAACACTGCTCACTCTTCCATCATACATGATTC
CATCGGTCACTGGAAGTAAGCGCTCTCGTGTCACCAACTTCTCGTCCTTGGGTTGCTGGCCATCCAGGTACACGATATCATATCGTGCATTACCATAGTT
GTGGGAAACTCTTGCAGGCCGAGTAGATCCTGTCTTCGTAGAGGTTTTCTGCGGAGTGGGGTTCGCAACCCCATCGTCAATTTTGGCCAGGCCAAGGGTC
GAGTGACGCCTATCTCGACTCTCTTCCGGCGAGACGACCGCGCCCCCGTTGACTCGTACATAGTCTTCTTTCTGTAGCTGTCCCTTCAAGACCCCGCCTT
CTACTTGCGACAACGTAGCTTCAATAGAGTCGCGTGGTTGCCACTCTTCATGAGGTTGTAGGTGGTCGAGGTACTCAACCAAGTAAGGGCTTTCTGGATG
CTCTTTTTCATCGAAGTGTTTTAACTTTGCGAGGCGCCCCTGTTTAATGTCTCGAACCCGGCGATTAGACACTTCGGGATCTTTTTCATCATGAAGTGGG
CATACAAACACAGTTTCCTCCATACCAAAACCCGTGCAGAGTTTTATATCGTACCTACCGCCTCCCCATTCCTTGGCAATAATCGCGGCAATAAATTGGC
CACCAGGTAGTTCCACGTCCACAGGCACTCCAGCATGCTTGAACAAAGGTAACTGAGCCGTGACTCGATCGCCAACGTGCAAAGGGCTCGACCGCTCTTC
GCTATTGCGACCCGCACCAACTGAATCGCCATTACTGGAGGTGAGACCACCACGAAGAGACAAGATATCGAACCCCGTCCACTCACACTCTGTGAAAAGC
GCTTCGATCAGGCGTGGTGTCTTCTTGCCATGTAGGTGCCCAGTCAAATAGTCTTTCGCCTCAGTCACTTGAGTGAGTACGCGTGACCATCGATTGAGCA
CTGCGTCCACAGCAACTGCATTTTCATAGGAGAGCCGATCTTTCTCTCCCTTACAAATACGACTTCGAACACGTACGCAAGTAGTTGCGGTGTCACTTTC
CAGTGCAGCTTGGACGCATGACGCATGATGCGCACCTGGGCAAGTAACTCGTCGCCAATATTACGACCAGGAAACACGTTCGTTCGACAAGTATCCCACA
GAAAGGTGTGGACATCCTTTTGAAGTTGCTCTGGCTCGTACCGCCCGCTGTTTTGGTTTAAAGTCCGAGAGTCAAACACAAGTCCAACCAAACGGAAAGT
GTCTGCCAATATTCTCCTTACGCGATCTGCCCGAAGAATTCCAATCAAATTGAGATCGAACGTCAACGTCGCTTTTTGCTTCGAATCTCGATCTGTCAGT
ACAAGCTTTTCATCTCGAAAGTTTGCACACTGCTCAGGGTTTTTCAACGAGAATTTGGATTTGCTACCCTCCGCTTTGCCTCCTGATTTGCGTTCCATTT
TCCGGTCTAATTTGCCAAGCTGACCCTCATAAACTCTCCCCTGTGACTCTGAGACTAAGCGTACGTCAAAGTAATCCACTTTTGATAAGTCGTATGTACG
GCCCAGGATGTTGTATGCCCCACCAACCGAGAAAGAATTCGCCTGAAGTGATTTTCCGATTTTCGCGGTATCAGAGCTCAATAGAGGTGCTGCTTGACGG
AGAAGTTCGCTGAACTTGTATGGGTTACCAACGCCGAGGTCTTCTGAAGCAGGGTCGTATTGGATTCGCAATCCTCCTTCGCCATGAGGCTGGAAATAAC
ACGTATACTCGTCCCAGTTTTCGTCCTTTAGGTCGACATCTTTGATCGCCACCTCTGCAGAGTACGTTGTGTCGAGCTGTTTAGCATTCGGGTCCACGTA
GTTTTCGTTGCGCATTATGTCCACCGAAAAGCGTAGTTTACCAGTAGTCCATCTGGGGCTGGTGTCTTCTTTGTTTAGGCTTCGACTGACCTGTAGCTGG
AAGTAGCATCGCCTCAACCTCAACGCGGCCATATTCATCCAGCGTCAGTTCTTGCATAATAGTTCCCCCGAGAGCATCAGCCTGTTTCAACACGACCCCT
CTAATATAGCCCGTTTCGCTTCGTTGAAACTCGATGGTTACGCAACCCAGTGGGTCATTAGCCGATGTTTGGTCGAAGTCCATCACACGAAGTAGCAGTG
CCTTCTTATCCCTTAGCATGGTTTTCTCCGTTTTACCGAGCAGGAATTCTTGGTTCTCCCACTTGGGGTTTAACGTCTTCATCTTGATGTCAGTTTTTAA
GCTCGTATCCCGCTCCTTTGAGTCATCATCTATCAGGACCATCTCCACAAATGGGTCGCTTGTGAAGAGGTCTGCTACACGTAAGCTTCGGCCCTCCAAA
ATCGATACCTTCACGAAGGATGGTTCCAACCCCACTACAAATGGGATTTCTTCTTGGGATCTCTTTCAGCGTTACCTTTTGGGGTCAGATTCTTTTCCTG
TGGTGGCGGCGGCGAGACCTCGCTTATAATTGCTTCAATAAGGGAAGGAACCTTCGCACTGCGCTTGATATCTCTCTTGTGCACAAGCTTAAGCTCCACC
CTTATTTGACCAAGGCGAGTTTTCTGAAGCATGTCACTGGCAGGTGCAAGGGGATACCATGCATCGACCGTACGATGAGGTGATATCATCCGAATAGGGA
TCTTTAGAACGCCTAGCGGCTTGTGGCGGTATCGGTGCTTCACCATGCGCGAAACACAATTCTCCAAATCTGTAGCCTTGAACAGAATGTTCAGATCGGT
GCACTATCACTAACTTTATGAGGGTCCAAATCTCCTTCGCTCGTGCGAATCAGCTCCCGCATCAGCCCCTCCTCGACAATCCGTTCGTTATTGTGACTGT
ATTCCACGTCGTACAGTAGGAACATGTCACGCTGCGCTTTAGGGAGGCTCAACCACGATGCTTTGTCTGTCACCTTGTACTTGGCCAACAGGCTGCTCAG
CGATTCTGGAACCTCCATTTTGTTCGAGATATCGTATTTTGCTGTGAACTGATATGTTGGATCGGTGAATGGCGTGCGAATCCGAACAATGCGTCCAGAA
TACAACGAGTCCCTCTTGAAGTTTCCACTTTGCATAGGCTTGGACTTCAGGTTTTTGCCTTTGCCATAATATGCCATCACGGTCTCACCCACACACCCTG
GCTTTTTCAGCTCTCTCCGCACTTGTGCACGGAGCTCGCGCGACTTCTTTTCATGATCCTGGTGCGACAGCTCCCTGTCGTGCCCAAAAACACAATTCAG
CAGCCGGTTGAAACTTCCTTCAAGATCGTTGTGATCAAACTCTGTGGCGTGCTTAATACACTTTTGCTGCAAAATTGTAGGGTTCAGCCGCTTCATCAGA
ACCATTTGGCCAGGACGCATATCAACGCAAACGCCTGAGCTTGTCAGCGCTTGGATCCACTTTTGAGTATGTGGGGTTTTAACTTCAATGACTTTGTCCC
CCTTATCTCGTGTCCTTGCCATTTTGTCGAGATTTTCAGCGGATATAGAAACGAAGTCTTGGGAGTCAGGCTTTCTGACGCACACTGTCGGATTCACAAT
ATCCATCCATCCTCCTTTCGCATCGTTCGTGAAGTTATAGGCTACTTTGCAAGCCGCACTTGCCATGTCAATGAAGGCCACCGGTGTCGTGGATGTTTCT
TGCTCATACATGTACAAGTGCTTACGACTTGGAACGAAAAGGCAATACTTCCAATCCCACAACACGTTTTCTGCATACTCTTCAGCTTTTTCAGCAATCG
TTTCGGCAACGGGTTGTAAAAAAGAGTTTTTCCTAATATCAGGGGAGAATAGCGTACTGGATGCCAAGGTGTGCATGCCTAAAAAGCCGTCGCAGTGCTC
AGTAAGTTTTTTTGCGTACGTCTTGCTTCGTTTGTTTGTGATCTGCTCCTGTTCGCTTGAGCTATTGCCTGCGTTCTCGTCCACAGATCTGAGCACAGGT
AAATCTGAAGCTTGGTAGCAATCGATTTCTTGAACAAGATCGATTGGAAACAAACTCTTTTCGCGTGACAGCTTTTCCATCCACATATCTACTTCACGCA
AGCGGTAGAAACGATCCACCTTGTATTCCAGCAGTACTTGCCTTTTGCCGAGGTCTGTAACAGCAGCAATCCCTGGAGTAACGTTTTCCACAAAACCAGC
AGCACACAATGCACTAAGCCACTGCAATGTGTACTCGCGCGTCGTTGGTGCTTGGATTGCGTCGGGATCAAACTCCAAGTTTGCGTTCCTCCACCCTAAC
CGACACGAAGACTCAAGGGCACTACCCCGGCAGTATTTTGTCCACCCATCTTCCCAAAGGACGGGAGGGTGACGCAAAATCCAAGAAATCATACCTTCAC
CTGTGAAGCTCCGTGGGACCGACAGAACTAAAGCACTCGTTTGGTCCCTCATGAAAAAGCTGCCGCTTTCGCGAAGGAGCCTCTGTCGATCAGCGCGCAG
TTTGACCCATTCTTCTCGAGGAATATCAGCGTCAGGGAAAATACGCGGGCCAGTAACTCCTGCCAAATCCAAGAGCTCATTTTCCAACCCGGCCACTACC
TCCTTCCGTGCTTCTAGCGATAGCTTGTCCATCGTGCAGCCGAGCCACTCGCTGGTCGGATCAGCATTCACGGTGTGAACTTGGCGACACTTACGCATGT
CATCTGCGGAAAGCACCTCAAACTCTTCGAACTGACGAATCTCGCGTAAAATGCTTACGATCCGCTTCATGATGACCACGAGCACGGCGTGAAATTCATC
GATTTGGCAATTCTCCGTGGGAGTCAGCGACGAACGAAGAATTTGTCGTCGCTCAATCCAAGTCACTCCTCGAGTTAAGATAGATGATGATTGAGCTTCA
ATTTTCACTTGGCGCTGGTACCACATGCTCAATCCACACACGGAGAGCCGGGGCTTAAAATCTCCTGCTTTGGTAGACGCTTGCATTTGTCGTGGCTTAA
ACGTATCCGACCATGTAGTGATACGAAGGAACAGGGATCCCACAAACTTATAATAAGGCACGTTCGTCGTATCGGGAGGGACAATCTGCAAAGTTAAGTC
CTGCTGTCCACTTTGTAGCATAGCGAGATCGACTTTCACAAACCCAACCGTTTGGTTACCTGCAGCGTCCTCGTTGTCCACACGAATCAGGATGCTCGAA
GCCTGTTCGAGAATCTGATACCCCATCTTTATTTCATGCGGCTCAACAGGCTGGTAATCAGTGTCCCCAGGCGGAGTGGCATCCACCCTACCCCATTACC
AAGGGTTTCTGCTGGAACAAATGCACATCATCGGTCTCTGCAGACCCATGCAGCACAGTAGCCGCCAAAACCTCTCCCTTTTGGCAGTTCCAGTTAGACA
GTGTCACTGTGTCACCCGGAATGAGCTCACCTTGTTTGTTAAAACGACACGTGCTGGATGCAACCTGTTTTGGGTTGCCAAGCATTGTAATTCGGCACGT
AGGCTTGCTGGTCTTATCCAGTTGTTTGAACTTTTGCGGCTTTCCGGCCTCATTTACAGGCACCAAAAGATCCGACGCCGATAAAACATCAATGACAATT
CCAGAAAACTTATGCTGCAGCTTCAACCACCGCTCATCTTCTTCTTTCTCCATGTCAAAGCGTCTGGCCATTACCATCTCGACCTTGTCCGTTAAACTGT
TTATCGGAATGAGTTGAGTAGGCTTTACAGTGTACCGCAAAGTACGCCTGGCTGAATTTGCAATAGCAGGTAGCTCGTTCTCAACGCTCACATCCACTCT
ACCATCACTGCGCACCGCCTGGACTGCTCCTTTTACATCGAACGAAATTAGGTTACGAAGCTCATCGATTGTATCAACTTCATCTTCGAAATGGACATCG
TATACATCGTCAGGGAACGGAATGTACTTCTGAACACGAGCCGGGTAAAAGCGTCCACCATTATCGCCACCACGAAAAGCCAATATTCGTTGACCGTATT
GCAGGATCTCGAAACCATCGTCATCAACCTCTCCGGATGGCGTCAGTTTATGCAGTTGGAAGCGTTTAAGACGTGCGTCTTGCTTCTTTTCGTCATGGTT
AAGCAATTTTGCCAGAACCTCCTTCTGATCATTCTGCAAATCTCGGCCGTATAAGTGAAGCGAGAGGTACGATACATTGGCAATATCCTTGATCTTCCCA
AATACGAAATTCTCTTCTGGCCAAGATGGATCGCGTGTGTTGTAGACAGTCAGACTTTGCTTTCGCTCGGCATCTTCCAGCCTCCCGTCGCCAAGGACAG
GAATAATGGTGAAGTAGATATTTGTCGCGTCTTGAGCACGTTCAGCGTTTCTCGACATTCCATTTGTCTGAGAATCGTGAACACCATCAAGCTCGAGTGA
AGACGACCCAATATTGGCACTTCCTGCCGTCTCCGTGAGTAATAAATTTCGAGCCTCGTGGACACGCAAGTGGAGTACATGAGTTTCACTGCTTGGGTAC
TTAGCATCACTGAAAACTCCAGGATACGACAAAGAGAGCGCGAACTTTTCTTTGCGCCACGTTGCTGTTGTACCGAGAACCCTCGAAGTAGATGTCTGAA
TAGGCAGTCCGCGCTGGATAACTTCCGTTGTTTCGTCTTCTAGCTCAGATCCGCCGATATCTGTCGCTGACATATCCATATCCATTGAAACTTCGCTTTG
GATATTTGCTTCTGAGAAGGTGAGAATACTTAGTGACTTTTCCATCGGGACAGTAGACACGCGTTGCATTAGCTCCGCCAGAGCGGTCGCATCTCCAACC
ACTTCGGTTTTTATACACAGCTCTCCCAAATCCTTGGCATGCTTTTTCATCCAAGGTTCTGGTTTAAGTTCATATCGTTTCATAACTGTTTTCGACGAAA
TTGAGGTAAAGCCCGCAGATGCCCGACAGAGATCATACAAAGGAATCTCCACACGCCCAAGCGGAGTGCTCCTCCAATATTGTTGTGATCTTTAACGTGG
ATCAAGAGTGACTTGGCATCTGAAAGCGGTACGCTCTGTGAGAACAAACAACAGCAAGTCAATAGAGTTATTCGCACAAATCAAAAACTACCGCGTTTCA
CAACTTACGTTACCAAACAGGAAGTTCTCGTTAGTCCACACTGGATTAAGCGTCTTCGAGACCACTGCTGTGCGCTTCTTTTCAGCATCGATAGCCTTTC
CGGTTTGATCAGTGATAGAAAGTGTACAGTACGGATCGCTGTAGCCATTCATGTCAGCCGGGCTGAGCCCGTGTCCCGTGAGGATTTCCACTTTCAGAAC
TGGTTTGTCAGGGTTAACCTCCAGCGATTTTTCCGATCGCATTTCGTTCTTCACCAGTTTTGATCGGTGCAAGGATACTTCCGCCTGGGAACGTTTTGAA
AACATCGTATTGCGTGCCTCGGATGCAGCAGCAGCAATCCGCTTGCTTTTTTGCGGAGACAACGGCGCACTTGTACGTTTACACCCCTCAACGCATACTG
ATGGGTCGATTTCGATAACAGCGTACGGAGTCGCGGTAGTCCCCGTATCACCACCTTGTTTTTGCTTCTGTTTCAGATCGGATGCCTCAATTACCGTCAC
TTCAAGTACTGCCTGGCCTTCCAAGCCAGCTCGGGCCTGAAAGCCTTCATCGGATGATACTTTCTCTTGATGAGCACGCGGAATCTGAGAGTTCAAGTAA
TGAATGCAACCGTTGATGCCATAAAAGCGAGGATCCCGTGCCTGGTAGTCGGTGACAGCACACGGATACGCGCCCCATCGAGCTTACAAGCAGCATCATG
CAGCTGGAACTGGGCGTTTTCCAACTCGAGCTGCTCAACAGAGATGTTGTGTCTTTTCGTGTTTAGCTCCTTTTCGATCTTCAGCTGACGAACATGCTCT
CCACGTCTCTCACCAATCAACCAGATTTTTAGCTGTATCGCACCAAGGTTTTCGCGAACCGACATGCCTTCTTCAGGTTGCAGTACGTGCCACTCTGTCC
ACTTGTGAGCCGAAAGCTGATCCAGTCCAATGTGAACAAACCCAAGGGGGTCATTTCGGTTGGACTTGTCGTAGTCGACTACCCTTACTTTGAGGCTGGC
TGCCTTCTCAATGTGGCAGATCAATCCAAACACGTGGTGCTCGTCAGCCCATGCAGGGTTACGCGTCCGATGCATGATTGCAGTCGTGGCGTATTCTCCA
GGGATGGGTTTTCCATGATCATCTAGCAGAGAAAGCTCGCAGTAAGGATCCGACGAATTGTTGAGGTCGGCGCTGATCAGGTCCCTCGCAGCTATAACAG
TCACTTCTAAGCGGTTATCTGTGTGCTCGTTACTTGCCGTAGCCACAGGACTTGTCGGAACGAATGCCAAGTCTGAGCTGTGGAAGAAGTCAACAAGATT
GGGCCCAGATATGCTCATCTGAACGCGCAGCTCTCCCCAGTCCTTCACGACGTGTTCCTTCTCCCGGGTATCATTGCGTCGAGGAGACGACGATAGACCA
GTTTTCTTCGGCGGCTCCACACGAAACCAGTCGTCGATCGGCTCCGACTGAGCCGTGCTTGCTGGGGACATGCGGAACCTCGAGAATGGCACCTGGACTG
ACCCCAAGCTGTCGTGACGCTTGAATGTATCATGATCGAACAAGTCGAACCGAATAGCCTTCACTGAATTCAGGTCGACAACTCTGCCAATCTCGAACGG
CTTCCTCCACGCCGGCTCGAGAGTTGCCGGGATCACCTCAGTGCGTTTCTCCTCGACGTCGATGACCTGTCCATCTTTGCCCACCAGCTTTACGACGCAA
TACGGGTCGCTTTTCCCGTTGAAGTCTGCAGCTTTCAGTTTGCGAGCCTCCTCCACAACAAGCTTGAGTAATATACGCGAAGGTGGGGCTGGAGCTGCAG
GTGGCTGAGGAGGCGTCGGTCCTATCGAAGGGGCAGATTCCTCCTTTGGCATCTCGGGGGCTAGTGTCTGCTGAGCTACATCAGGAGTCCGGCGGTAGGC
GTTGTAGATAGCCGTAATCCACTCGTCCTTCTCGACTTCGTTCTCTGCCTGCATGTAGAAGCTTGGTTGTCCAGGTGCAGGCTGGAACAGGATGCAGAGC
GGATATCCCTGGTCATTCGTCCGGAGCACACTTGTATCCAGCGTAAGCTCGTAGCAGCGCCGTGGCGCTGTGTCTTGCGGCGTTTTGTAGTACAAGAGCT
CGGTGCGAGTCAAGCGGAAGTACCTCCGCCGCCAGTTCGACACGACCCTGCCCGACCGGCTGCGCTTCATGAGCCATCCCTCCTTGATGTAGCGTTGGTC
ACTCATCGCGGGGAGACGGCAGCGACTTACTTGTCTCCTCTGTCTTCCTAGTGCAGTTCTTCTCTACTTTAGCCCGCCGTCACTTGCGCGCTCGCTGTCT
TCTTATCTTCTGAGGTGTCCGTGGCCAAAGATCGCGATCACCTTGAAGCGTCGTCGCGTCCCTCTGCGGACAGCTCGGGCGGTTACTTGATCCCGACCAA
CTTGTCATGCATTTCGTGCTGCTTATCCGATAAAGCTACGACTTGGCTCCTTTCTGGAAGAAAAGCGGTGGCGGGAGCTCTAGGGGAACAGCAACTCGCT
TTTGATAGCATTTACCGGTGCATTTCGAGAGGACGTTGGCTCTCGGCCGGAGCGGTGACTCATGCGTCGCGGACTCGTTGCACCCTTGTTCTGCTTGTAG
TAAATCAGTTTCCCCTCAATGCTGGAGCTCGAGCTCTTGGTCGTTGGCACCTTCGCATCAGTCCGTACGGCACCAAGTTTGCGACTGCCTCTCAGCGCCG
ACTCGGCTGCTCTGTCCTCGACGAGTGTATTCTCGTCACACTGCACACTCGAGTCTACCTTCTCCAGCTTCTTCTCCTCGTCGCTGCATCTCTCCTCCTC
AACTCGCTCTACTGCAGTCGCTGGTCGCTGCGTCTGCTGCTTCGTCTCGTGTTCCACCCGAGGACTCGACGGCTGCGACCTGTTCACTTGTACACCGAGC
GCCTTGGTGATGTGCGGGGCCAGCGCCTTCCCGAGACACGAGAGCGTGACGGCTCCAACCACGTGCCCCACAACGGCGTTGCGGTGGTCTCGGAGCTCCC
ACGAGTCGCTGTGGCTCGCCCACTCACAGATGCGCAGCAACCTGCTGCAGCTCAGCACGTCGTCCTCTAGCCCCACGTTAAGAGGCAGCGGGACAGCTGC
AAAGGCTCGCAATCGGGCCCTCCCGCGCTCCTGGAGCAGCAACAACAACGTCAGCGGCGCCTCCGCGTCCTGTCGGAGCTCGCGCACGAGCTCGTCCGGC
TCCGCTTCGAAGAGACAGGATTTGCCATGCTTGAGTCTCGTCACACAAGCTTCACTCTGCGTCTGAGAGGCCTTGGAGGGCGTCAGCGGCGTGTCGAACA
CGACGATCTCGTACTGTAGCAGCTGAAAGCCCAGCACCAGCGCGTTCTCGAGCTCTGCACAGGACGGTAAGGCCGTTAAACATACTCGGTCCACGTAGAA
CTGCAGCGAGAACAGCACACAAGCAGGTAGACGGGCAGGAGGTCCACTGAGCGCGTCGGAGTCGCCGGACGTCACAGAGAGCGCGCCATCTTCAGCGTCC
ATCGATTAACTGATATAATAGCGGTTATGTTAATGTGTCTGACCTGTCAATACCGATACTTGAAGATATCGTAAACCACAGGGCATGCCAATGCATCATC
ACCTCACATTTCCAGCAGCTTCCGTCATGCTGCGTCGGTTCTCCTCGTCGGCGGCGCCGCGCATGGTGCAGCAGCGCGTGCAGAGCCAAGTATCGCTGCT
GTCCAAGAGCTCCACTGCACCCAGCACGCGCGTCGTGTTCGTGTCTCGTGCTGCCGCGTCCGACGTGCAGAAGTCGCTGCCGTTCCCCGTGTCCGCTGCT
GCGCTGCGCGACTTCCAAGCCAAACCGCTCGAGCGAATGTTCCTGTACCCAAACGAGGACGACGCCACGCTCCAGACCCAGCGCGTGCTGCTCGTAGGCC
TCGGAGACGCCGAGAAGGTGACGCCCAATGTGCTGAGGAACGCCACGCACGGCGCCCTCAGCGCGCTCAAGGCCAAGCGCGCCTCGAGCGTCGTGTTGCA
GGTGCCCAGTCTGGAGGGTGGAAAGATGGACGCCGCTCGAGTGGTGGAGCTGATGTCCCAAGCCTCGATGCTGTCTAACTACCAGTTCGACCAGTACCTG
ACGGAGGCCAAGGACGTCTACGGAGACAGTAAACTGCGCCTGCCACTGGAGCAGATCTACTTGGACGCGTCGGCTGAGTTCCAGAAGGTCAAGTGATTGC
TGGAAGTTTTTTTGTAGTGTTGAAGGAGACTGACCATTGAGTGACATTGCAGAATGTGGCGGAGCAGGCGACGGTGGGCGAGGAGACCATTTTCGCGCGC
AACCTGGGTGCGTACTGATTAAGAGTTGGCCACGTTGTAGTTCTGGGCTGACTTCGGTGATGCAGGCAATGAGCGCTCGCACATCGTGAACCCGGCATTC
ATGGAGGAAGTGGCGCGTGCTTCGGCCGAGCTCCCCAACATGTCCGTTCGTGTGCTGCAGCAGGAGGATCTGGAGAAGGAGGGCATGAACATGTTTCTGA
GCGTGGGTCAAGCTGGCATCTGCCCTCCTCGTCTGGTTATCCTCGAGTATCGTGGCAACCCCGAATCCGACGAGAAGATTGCGCTGGTGGGCAAGGGTGT
CACGTTCGACACGGGAGGCCTGAACCTCAAGCCTACGGGTGCTATTGAAGACATGCATACTGACATGTGTGGCTCGGCTGCTGTGCTGGGAGCTGTCCGT
GCCGCTTCGCGCCAGGGTCTTAAGGTGAACATCGTCTGCGCTCTTGCTCTGGCCGAGAACGCCATCGGATCAAAGGCCGTGAAGCCACTTACGATTGTCA
AGTCGCACAAGGGAATCACCGTGGAGAACAACAACACCGATGCTGAGGGCCGCCTGGTCCTTGGAGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCC
CAAGAAGGTTATCGACGTGGCTACTCTGACTGGTGCGTGCATGATCGCTCTGGGTGAGCACTGCGCTGGTCTATTCTCCAACTCGATGACCTGGCCAAGA
AGCTGCAGGAAAGTGGTACCGAGTGTCACGAGCGTTGCTGGCGCCTGCCAATCCTCCCTGAGCACACTGCCGCGCTTAAGGGTACCCAGTCGGACTCCCG
CAGCACCGGTCGTGTCCGCTACGGAGGCGCCTCCACGGCTGCTGCTTTCCTGCAGCAGTTTGTTTACGAGGGCGTGGATTGGGCTCACCTTGATATTGCT
GGGCCGTCAAATTACAGCTCTGCCAAGTCGTACTTCCCCAAGGGAGCTACGGGCTTTGGCGTCCAGCTGCTCTACAGCTACTTGAAGGAGCACGAACAGC
ACTAGAAGGTGCTATCTGCCGCCGGTTTTGTTGTTACTCAATAGAAATGGCAAACAGGAGAGGCGTGTTGAAGATGTTAATGGTGGTTAGTGCTCTGTGT
ACAGATTCCAAACGAAAACGCAGCCATCATCACCTACAGAGACAAGCTGACGATCGTCTGGGCTGAAGGCGAGGCCGCGAACATTGCCCGAGTGGCCTAC
GCCGTCCATGATCAACTGGTTGGTGTTAAAGTCCCAGACTTTCACGAGTCGATCGTTCCCACCGGTGGCAAACACTTCGAGATTGTGCGCTACAGCGATG
CAAGTGGCCTCTTCGTCGTGGGCCTTCTGGATCACGGTCACAGGTGTGTCGATGCGCAAGTCCCAGTAAGATATGCGCTTTTCCTGGCCAGCACTCAAAA
CTAGGTGTTGGTCAGCAGACAGCGCCACAGTGTTGATCCCGCCCATGCGCTGGATGTGACTTGAAATTCTCCGTTCATTGCGCAGGTCCCAGCAGAGCAA
ACTGCGGTCTCGACTGCAAGAGATCACGTGCAGATCGTCGCGATACAGCGCCAGACTCGTGACTGTCATCGAGTGCTCTTTGAGGTGTGAGACCAAGTCG
CGCTTGCGAATATCCCACACGCGTACTTCACCTCCAACCCCCGCGGACACGATGAAGCGCTGGTTGTGGCTCAAGACAAGCGCCGTGACTCCACCTGTAT
GAGCATTATCAATGGACCAGGCCAGGTCACCAGAGTCGCTGCTATGAGACCGGATGCAGCCATCAGTCCAACCTGAAAGAAGCACGTCTAGCGAGTACTG
GAGAGATGTCGGTGCTCCAGCATCACCAACCATGCAACGGGTTGCCACCGAGTAGTCGGAGGCATCCCATACTCGAATAGTGCAGTCTCGAGAGATTGTG
GCGAATCGGTCGGACACGTCTGGCGCGTATGCTATCTGCACGACAGCGCTCGAGTGGTTTTCAGACAGCAAGCCAGCCTGGAGACTTCGTTGGGAAGTGC
CGAGCGCGAGACGCACGGAGTAAATCCCCCCGGCTTGGGTGCCGGCAACAGCCTCATTCTGTGCTGCATTCAGAGCTATACCGACGACGCCGCTGTCTAG
GCCAACGTGGCAGGTGTCCACGAAGTCGTGCCCGTAGTGCAAGACACTGCCATCCCCGCCACCTACAAGAATACCGCCATCGAAGTACAAAATGGAGTCA
CGCCGCAGGAACAAGCCGGAACAACCTTGAATAGCTGCCGCGTTTCACGCCGACCACGCAAAAATCGCCACTCGAGCTGCCAGCAATGAGGGTCTCACGG
TCAGGCGAGAACTGCACGCAGGTGTAATCACGAACGAGAGTCTGCTCGATTTTGTGCGGCATGAGCTCACCCGTGACAGGATTGAGGACCCAAATCTGCA
GCAATCGGTGCCCGACTGTAGCAAATTGGTAGTTGGCCGTGTCGCGGCGCTTTACGTCACGCGCCATGCCCCCAAAGGCAACCGCTGTGACGATGCTCGA
CATCTTTTGGTGCGTGGCGCAAATGTTACCTGTCAAAACGTCCCAAATGTACAGCCGGGGGCCGTCCTCAGGAACACCAACGGAGCATAACAGTCGCTCG
TCATCCGAGAAGGCAAGTGCAGCGATACCTGCGTCGTGCTCAGATAGTCTAAAAGCTAGCCTCCGGGCTGAATAATCCCACACCAGGATATCTGCACGCC
TGCCACGCTCACCCGAGGCTAGGATTCTCCCCGATGGAGACATGGCAATGCAGGTCACATTACCCTCATGACCGCGCAAGAAGACCTGGCTGTGCGCGTC
TTGGAAGGATGTAAGCAGCACCGAACCACCAGCGGGATACACGTAGTCTCGGCCTGCAGGGTGATAGTGAATTGCGTTCGGTACGGCGGAGAAGCCAATG
GTGTGCTCCAATTCAATCACGGGCGACTGCTGCAGCTGCTTCTCCCGCCCTCTTGAGCTCGACTTGGTATCCATCAGAGCAGCGCCTTCGTATCCACGCA
TGTTGTTGCCGCCATCATACTGCATTATGACAGACGCGACTTCTTGGAGCAATCAGCAATGAGAACTTCCCATAAGGAAGAGCCTCTAGCAACTGCCGAC
CGTGGAAAAGTAACCACTAAAACTAAACATATATCCCGAAGTTATTTACTCAAGCTGTGTCCCAGACTCGAGGAGCCCCGTGGCGCCAACATAACTCAAG
CACGTGTAGTACGGAGCCAGGTCGTTCTCGTGCATCCACCGGGCGACGTCCAGGCCAATATCCTCCTGTCGGTCGAACAGATTCACTCGCAGGACACCTC
GAGCCAGAAACACTCGGGAAGGCAGCTCGAACGTTTGCATCTACAGTTAGCAGTGGTAAGAATTTCAGTTGTCATACCCAGCTACCGTTAGGATAGTGCG
CTCGCACCTTCATGTCCTTGACAATGCTGAACACCATGGACTCGTAGACCAAAGAGCCCATCTCTCCGTCTTCTTCCAGCTCGTACAGCGCGAACGACAA
CCGCTTGGGCGAGTACGTCGGGCTGCCGGGGTACCAGAACACCCTGTACGGGACAATCTGCACACTGTTCACCATGGAGTTTTCCCACAGCGTGTAGTCG
AGATAATCCGTGGTCGCGTATCCCCACGTCGAGGCACTGGCGCAACACAAACACCAATGAGCTTCAACAAAAGTCCCATCTTCTCGATCCATCACTCGTC
TCACCTGCTCCAGTAGCACGGACGGCCTCTCGCACAGCCGCACTCAAGCTGCAGCCTCTTGGCGATGGCTTCGAACGCCAACGGGTCGTCCACCACCACC
GTATTGGCCAGCAGCGCCACACCAACGCCACAGTGCGACTTCGTGAGCGTGTTCTCCGCCGATTCGTTCGTGTGGTCCACCGACGAGCACTCTACAAGCA
ACAAACAGTCTTAGATTCCCTTCCTCCTCCTCATCCTCCTCTTAGCACCAGGCAGCACCTCGCACTTGACGCAGCAGCGAGAGATCTTCGCCCACGGGGC
TCTGAGTTAGCAGCGCCAATCGCTTCCAGTCCGCAGAGCTTCTGGTGTGGCAGCCAATCGCGTACAGCGCCATACGCCGCGCCAGGAGTTGCCATGTGTC
TGTCAGACAACAGTATCCGAGTCAGAAGAAGAAGAAGCACGTTAAAGAGCCAATTGAGCACGCACCACAGCCCACGATGGTGTCCCGCACGCGGCGGTTC
ACGGCCTCCAGATGCAGCAGCGACGTGTGGTCCACGAACTGCAGTATCGCCGCCAGCATGTCGCTCGGCAGCTCGCACAGCCCCATGTGTGTAGCTTCTG
GGCGACAGTTGAACTTCTCAGTGCCCGTACAATGCTAGCTCTCAAATTGTCCGTAGGGTGATTTGGACTAAATAAATATGAACGGATATGAAAGGGTATG
TTAAGAACACGTCTGAAACCTTCGCAGTGACTTTCACATCTGCCAAGTTGAAGTTGTTGACAACATGCACAAGCTACATTTCGTGTTTTATCACTCCTTG
GCTCTCTCTCTCTCTACATGTACACTTGATCAGTGAAGTCGGACACATTGCTGCACGTCTAGTCGTCCCACTGATTGAGCGCCTGGCGGAGCATGCGCTG
GAACTGCGATGAGGCGGCACGCTCCTTCTCGATCTCGACCCGGAGACGCTTCATCTCGCCCACAGCGCGGTACTTCTGCAGCGGATCGTCGATTAGGCTC
AGACTCGAGCCTGCAGACTTGTTCCCAAAGCTTCGCCTAATGCTCTGCACGGAAACCTTCACGGGTGGCTGCTTCGTGACGATTCGGTCGCGCTTGGGGC
GCTGGCTTGAGACGTGGAGCTGCGTCGGCAGTGGAGAGTGTACAGCATCCAGAAGACTGGCAACGCTCGAATTGAACCCTCGCCAGTCCGCGGGGTAGTA
GATGGCAAAGTCGCTCAGCGTCTCGAAGAAGGTCTCGTAGATCTCCTCAAAGATCTTTCGCCAAGGCAACAGGACGTCCGCCTCCTCCGGAGTCACTTGA
TTCGCGCTTCCGTCCACGCTCTGCATCAGACGTTCATGCACCGGGAGCAGTAAACTGTAAATCCGCTTCTTGAGTTCATACGTCGACACTGCAGTGGAGG
CTGGATACGAACGGAACAGCCGATCGACGAAGTCCACGATCTTCTTGAAGTAGACGTCGCAGAGCTGGTCGCACTGTACAGTGGAAGGCTCGATTGCGAT
GAAAGTCACTTCTAGCGCTGTCAAAACCGTCCTGATCTCATGCCGCTTCTCTTGCGAGTTCCAACCGTGCGGGGGGTCCACGACAACAGACTGCAGCTCT
GGTGGCGGGTACGCTAGATCCATTACGCCAGACGACAAGATGTCTTCACGTACGCGCGGGAAAACCGCACAAATTTGGCTCTGAATACCCACTGACGATT
CGTACTGGTTCATCATTGCCTTGACACTACCCTCCAGCAGCTCTCTCAGACCAACACTCTTCAGATTATGAACGGGGGGAGACAGGGATGCAATCTTGGA
AACCACTTGCCTGAACTTCTGGGGAAGAAGCTCACCAGCGTTTACAAACTCAACGACAATGTGGACAACTTGCGGGGCAAATTTGCTCTGCACTCGTTCG
ACACAGCTCTCAAGCGTACTTGTGACAAGAGAGCGCAAGGACCCGATTTCGGACGAAGCAAACCCCAACACAAGCACACTCACGCGACACCCTGGTCTCA
GTAGTGATAACAAGTCTCCCAGGCGCTGCTCCCAGCTAAAAGAATTGCCTGCTTGCAGCAATGTACTCAGGTCAACGGGAAGTAGGACCGCGGACGTTGC
AGCGAGCTTCTCTCTCTGTACCTCACCACCGTTTCTCTGAGTAAACGTCGAATCAAGATACCGACAGCACACATCCACGCCCTGGTTGGACTGAAAAATG
CGATGGCAGTCATGCTGGGGTGTCGTAGCATCTTGTGTTCCAGCCTTGACCGCACACCACAAGCCAAATGACGAGGAAGCTCCATCGAGAAGATCCGCAA
TCACCAATTTCCACGCGATCGATGCTGCACCGGGGTTCACAAGCCGAAGAGGAGCACAGACCAGTCCTAGGATGTCTTCGGAGCTCCAAAGTGACGATAC
TTCTGTGTCCGAAAGCGGTGAGTCCCCTTCCGACCTAAACGCTGGCTTCAGTCGCTTCGTACCAATAGATACAACATTGGTCCCTCTGAACAGCCACTGC
ACACTGTCTTTTGCCTTTTGATGAGGTCGCACTTGCCGAAGTTTTGCTGCATCGATGGCAACTGGGCCAGGGCCGGTACGTGAATCTTGAACGTACTTCT
TCCAGAGATGCAATCTCAGTTTCAGGACGGCGAGCCTTTGCATTTCGGCGCGACGCACCCGCTTTCTTTCGGCCCGCTCTTTCGCCAATTGCGCTTGTCG
CTGCGCTTCAAGCAGTGCCTCGCGTTCCTGGCGAGCTCGTGCCTCCGCTAGTTCTTGCTGGCGACGTCGCTCAAACTCTTCTGCAGCCTTCTGCCGAATT
TCTTCTTGCCGTTTCTCTTCTTGCCGGCGTCGCTCGTCCTCGACAGCCTTTATCCTAAGAGCTTCCGCTCGCTGCAGTGCTTCAAGCCTTTGCTGTTCTG
CCTCACGCGCAACTTCTTCGGCACGTCTGCGCTGCTCTTCGAGTTCACGCTTCTTCTTTTGTTCCCGTAGTTGAGCTTCGAGTTCTTCTTGCTGTCGCTT
TGCTTTCTCGGCCTGTTTTTTTGCTTGAGCGCGTGCAACAGCTTCCTTTTCCGCGTGTTCTTCACTTTGAGCTGCTTTCTCCACCGCATCCTTCTTAGCT
TGATCTTGGCGCACCTTTTCTTCCTTCGCTTTCTCTAGTTCTCGCATCCGCTCCAGCATAGCTTGCTTCTTCTGTTCAAGCTCCCATTTTCTCTGCGCAA
TCACATCGAGATCGTGCTTTTTGTGATCGGTTTCTGCAGGCTGGTACTGAGTATTTCCGAAGCTCACAGAGATGTTTGAAGGCGTTGGTGGAGCACTCGC
TGGAGGCGCCGCTGGTGCTCCGTCATTGTAATCAACAAAATAAGAGTAGTCGTCCTCATACGCAGGTCGATTCGGATACAGCCTTGCTTGCTCCCTCTCG
CTCGGAGTCTTGGATCAGCTTACTAAGCGCTGGGTATTCATCGCGTGCGTATTCGGTCACACCGCGGCAGATATCTCGCCGAAGGTAGTTGCTGCATATA
TCAAAAGATTAACTACGGAGACACTTCGCAGCCACAAAACTAAATAATCCGTACCCTTGCTTCATTCCAACGTAAATCTTGGAACTTCGAATCTTCTGGG
GTGTATTGTTCCGCCGTAGTTGCGCATCTGCACCATCGGCATCATATAACCATAAGCACAAATGCCACCAATCGCAAGCCTAATAATCCATAATGTACCT
GTCTCGAAATCGCCACCGAACTTCACAATCACTGCGCTGTCGTCACCAGTTCCAGGCCTGCCAGCTATCCTCAAGCCATGCTCTTGGCACACTGAGTAGG
CGTGCTCCATGTCATCAAAGCACAGCAATTCAACCAAATCCTCTAATGGATAGACCTGGCTACGATAAGCCCGGTTCATACGAAGCAGAGCTGATGACCG
GGCATTGGGGATGTACCGAAACAGTAAACATGACTGCAGGTAGGTTGCTTGACGAAGCAGCGAGAAAAACTGGAAGTAATCACCCGTGTGCCGAGCAACA
AACACGCGCATCGCGAACTTGATGTGTGGGCTCTCCAAGATATGATGCGGGAGAACCTTAACATACTTCAGCACATCCATACCGCGGCCATTGTCCAGTG
CACACAGGATAAAGTACGCACGACATTCTGCCTCAAATGGACTCAAGTACGCGGGATCTCCAACCTTGCGACTTTCATCATACAACTCGTTGAGCGACTT
GAGAGTTTGGCCAAGCTGCTCCATATTCTGCTGCGCCACAAAGCTTGGTGTCTCGATGAGTTCGTGCTCACTGAGCACGTGGTATCGCGCAATACGCTCA
TGGATGTCGAGAGCGATGGGGTGTACACGTCCTCCAGCGCCGCGGTAATTCTGCAACACGAAGTCTTTTCGAATCATTCGAAACCGATCCCAACAGAAGT
TATACAACTCGATCGGGCCCGGAACTCGGGGCTGCTGAAAACGTGGATCCTCGCCACATTGGTCCAAGTCCATAATTTCCTGCTCGATGTAAAGTTGAGT
GCGTCGAAGAACTCCAGGAGGGCGGATTTCCTCTGGAATATCCAGCTTATGATCAGCTGAACTGCGTTGGAAGCGCTTGATAATCCTCTCGCGTTCAGTT
CCTGGTTGGTTGGGGAAACACTTTTCGAAGACACTCAGCTCATCCACCCGAATGTGCAGCTCCCGTTCTGCTGGGCTACACATGTCAGCGCAAAGTCCAT
TCAGATTAGTAGCGGCTGAAAGTTCTGCTTTGCTGCTTTCTTCGGTGGAGGCCGCAGAAGGCATGGGGGCGTATGAAGTGTCTTCATCGCTCGTACTCGG
CGTTTTCTTCTTTGGCCGAGATTGTCGCTGCTTCCCATGCTTTTCATTAGTTGGGCTTACCTTAGGCGCCTTAGCAGCACCAAAAGCGTCTCCTCCAGCA
GGAAAGTTTCGACTTGACTTAGACTGTTGTCCAACGAAGGGGTTAGCTCGCGTTCTCCCGAGACACCAGCTTGTTTTCCTTTCTGGAACGGCGATTTCTT
TGCGCCACTCATTCGCGCCTCCATGGAGACCATCTTGTCTGAATTTCCAAATCCTCCTGCGGATACGTCTGAACCAAACGTTGGCGTAGTCTGTCGTCTC
TTATCGGTGACACCACCGAACGTGGTCGCAGGAGGGCTGCCAGCAGGAGAGGGTTTCCCGAACGCAGGAGACCTAGAGCTATTACTACCCGCAGCTCCGC
CAAAACTTGTATGAATAGCCGGAGCATTTGGTGCACCTCTTCCATTACCCGCCGTCGCAAAATGGTTGTCCGATAGCGAGGAAGATGCAGTGTTTGGGGT
GATTTGCTTTTTTCGCACTCTCGCACCAGATGCTTGGCTTCCGAAGGAAGTCCCTGGCGTCGACACTGGTGCCGGTGCTGCTGTACGACCCGACCCAAAA
CCATTCGAATTCTGCGAGAATGATCCCTGTCCACGCTTGGGCGTCGGCGCCCCAAAAGTAGTCTGTCCTGCACCTGGCGATGACAATGGTGCCGGTGCTG
CTGTGCCACCCGATCCGAATCCGTTCGCGTCTTGCGAAAAGGATCTCTGTCCGCGCCTGGGTGCCGACGCCCCAAAAGTAGTCTGTCCTGCACCGAATCC
ATTGTCGTTTCCTCCAAACGCTGCACTGCTTCCACCGAAAGATGCCGATCCATTGCCACCAAACGCAGTCTTCGGTGCATTTCCACTATATCCAGTCTCT
CGATTCTTGGGCTTTCCACCTGTAGACGACGAAAATCCAAACGTCGTGTGTGCACCCGGTAACGTAGAAGAAGTCGACACGCTATTCTGTCCAAACGTAG
TCCCTGCACTATTGTGTGCCTTGTTGTTGTTGTTGTTGTTGGTTTTCTTCTGTCCAAACGGGTTTCCACCGGTCGAAGTGGCTCCAAACCCGCCCCGACG
GAGCTCCAGCCATTCCTCCGGGAGGAAGTGGGGGCTGATGTCCGAAGCCTCTGCCCGGAGCCCCAGCCATTCCACCAGGAGGCAGTGGAGGTTGATTGAT
AAAGCCGGAGCTCTGTCCGAACGCGGTCTGGGCCACTGGAGCGTTTGCATTGGACTGGAACTGGTTCATCGTTGAGGATCCTGGACACGCCAAGGGCACC
GATCAATACCTAGAGACGCCTAGAGACGCACACACAACGAGAGCAGAGCAAAGCGCGTAACCGTAGCCATGTAACCTCCGTACCTTGACTCTGCGCGAAC
GGGTTACTGCTCTGCGCCGCGAAGCCGCCGCCTCGATCTGCACAGAGTGGACACAACGTATCAGCTTGTAACTCGGGAATCACGTGGCCAATGGAAGCGC
AAGAAGGTGGAGAATAAAAACGAAAAAGTGGAGAACGCACTTCCGGAGCTGAACATGCCGGCGTCGTCCCGAGAGCCGCTGCGTCGTCGCTCGCAGGTGT
CGTCTGCGGTTCCTGGGCCCGTTGGGAAGCTGAACAGGGGGAGATGCAGCTGCGGTACCATGTACCGTTATGCGGTCGTGTGGCCCACCTTATCTGGAAA
TCCTAGTTCAGGCTAATGCGGTCTAGGTTAGGCAAGATGCTGCGATCTGATTGGCTGTGAGGTCAAGGCATAGTGAGCCCAAGTGAATGTCAGGACTGGA
GAGCCTTGCGCGTTGGGGAACCACCAATTCTCGGGCGCTGGCTCCGCCTGCGATTGTTGGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTT
CGCGCGAAGGTAACTACGCCCCATGACGGCGGCAATGACCAGCGACTCACACTGCGCCTTCCTCTCTCTGTGTATCGTAGTTCAAGATGGTGAAGCACAA
CAACGTTATCCCCAATGGCCACTTCCACAAGTACTGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTAAGACAACAGCCATGACGAAACTTTTACAAC
CCCCAGCGGCTAGATGCACACACACCCCATTAGCTTCTTCAATCCGTCTGCCACCATTGGACAAAACGTCAGAGAACGAGAACAGGTCGACTGGAAGGGG
ACAGACAGTGGATCTCTCTAGCGGAGACGGATTCAATGGGCGTGTGGCGCTTTAGCTGCTGGCTGCAGACAACTACGAAGGATCTACGTACTGATACAAG
TGACATTATGTTGTGACCTACCAATAGGCTGCCAAGAAGAAAACCCGCCGTCTGGCACGTAAGGCCAAGGCTGCTGCCATTGCCCCGCGTCCGGCCGCTG
GTCTGCTGCGCCCCGCTGTGCACTGCCCCACGATCAAGTACGGCTCCAAGGTCCGTGCTGGCAAGGGTTTCACGCTGGAGGAGCTGAAGGAGGCTGGCAT
CAACCGCAAGCAGGCCATCAGCATCGGCATTGCCGTGGACTTCCGTCGCACGAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCC
TACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCGTGAACAAGCCCAAGAACGGCGACTCGTCCCCGGAGGAGACCAAGAACGCCGTGCAGTACACGG
GCGCGATCCTCCCGATCACCCGCTCGAGCGTCAAGTCGACGACGGCTGTCATCACGCCCGAGATGAAGGAGAAGAGCGTCTTCACGCAGCTGCGTGTGGC
TCGCGCCGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTGGCTGACAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACACGTGCTGGCTTGCTC
TCTCAGCCGACTTGCTGTTGAGAGGGTGGGCAACTCCCTAAGGTCTTTTGCGGAACGTTGGAACACAATATATCGCGCATCAAAAAAGCTCGGTCTTCTT
TTTTGCATATTTGTGTTTGAGGCTTCGTGTTGCAGTTTAAAGGCAATATCGTTTAGACTTGGTATTTGACCACCTAAATCTACGTGTTCACACTCTTACG
TCGGCATACGCCTCTGGTTCCGACAGTAATGGTTGTTGCTCTGGTTCGTCGGACAGCATGATGGACTTGTACTTCACTGGTCTTCCCACCAAACTGTTGT
TTTCTGAGGTGTCAACCTTCTCGGGCAGCACGCAAAGGAACACCAAGACGAGCAACTGGCCGACAGACGCAATCACCACGACCAGCCACAGATGGCTCCA
GTCCACAACCTTTGTGGTCGGGTCGGGAACAATTCCGAGTGCCAACACCAGTAGTGACGTAAGAACTCCCGACACAACGCCGCCGAAGTCCATGAACGAT
AGGTACAATGCGTACGTCAAACCTTGAACGTCCGAGTTTGAAGGGCAGTAGTACGTGGCTACTACTAGCAACTGCAACAGCGCGAACTCCGAGGTGAACG
AGGTGATAAAAGACTCCACTGTGCCAAACGTACACACTGAGACGGGAAGCTGCACGACAGGTGGAGCTAGCAACAGTCGTGGCAGACCAGCAGCAACAGA
GCACACTGTAGAGAGCAAAAAGACGCTTCGAACACTCCGGTTGGTGCACCACTTGGCGTACGACAGACACGACAGGAAGCGCCCGACCATGCCAGCGAGG
TACATGTACTGCAAGCACTCGTGCTCGTCTTCAAGGAGCGAGAACGTGTACTGGTACCATATCGTTCCATCGCCAGGCAGTGCATTGCACAAGAAGAAGA
AGAGCATGGGCGGCAGCACCGGTCGCATGAGTTCCCATTTGTGCTGAAGTTCGCGCTTAAACGGCAGCCACCACGAGTTCAGCAAACTTGTCGATGCAAC
AAATTCAACAGGTTCCGATTCTCTGTCGTCGTGTAGCTCATCCACGGGTGTCTCCTTCAATCCAACGAGACACACTCCCGCCGCTGCTAGCGGCAGCATA
CTGGTCCATCCAATAACCTGCTGCGGCGTGATGCTCTTGTCTCGATACACTGGGATGCCCAGCACCAAGGCTGCAATCGACGCCACGTTCTTGACGCCAT
TGGCCAATGACTGCACGTGTGCACTGCTTCTACTGGAGGCATCTCCCGTCGTCAGGTCCACCAACAAGACGCCGAGCATAATCTGCGCGAAGGCTTCGGC
CACGGCGTCTACGAGCTTCACAGCGAAAGCGCCAGCGATCGAGTGCACGTACGTGGCCGTCAGCACCAATGAGACTGCGGTAACGACCTCGCACAGAACG
ATGTACGACTTGCGGTGGTACCCGAAAAGCGGGAGGCTGTCGGACAGCAGGCCGTACAGCGGCTTGAGGTTCCAGGGGAAGAACGTGACCGAGTAGTAGA
GCGTCGTGGTGGCTGGCGGCATGTGAATGACATCGAAGAGCCACATGCCGTACGCTGTCATGGGGAACGACATGATGAACGAGTGCAGGAAGTAGAGCGC
CAGCAGCGCCACCGGCACTCGCGTCATGGCCTCTCTTCCAGTCTCAGCATCTGATACGCATGGCTTCAAGCGGCACTGTAAACGACACAATAACAATCAT
GTTGTATCCAACAGTAATTTCTGGCGTTTGATTGGTGTGGACGAATAAACGTATTTGATTCGTTGAAATACAATGCCATGCAAACTGTTGTCATTGGCAG
AAAACCATTACTGCCACGAGCACCAACGCACTAGACTATCGCCTGGCGGAGGACGCTCGAAGATGGCGCGCGACGAGTTCAACATCGACGAGGCCGATGA
CTTCGACGACGGCACGCGAGCGGTGGTGCACGCGGATGCGGCGTCGGATTCCGATGCAGAGGTGCAGGATGCAACGCGGCTGCGCTCGTCCCGCAAACAG
CGACTGCAGGCAGAGCGCAAAGGAGGCAAGCAGCGCGAGAAGGCGTCGGCTCTGCGCGTCAAGAACTGGGACGCGCTGGAGAGCGCCGAGTACGCGGGCA
AAGTGGTGAAGCGCAAGGAACTAACGGAGGATGGACTGGAGTCACCAGACGAAGATGCAATGGCCGAGTGGTCCGATGCTGAGCCGTTCGGAACGTCGGA
AGATGAAGAAGAAGAGGTCGAAGAAGAGGAGGTTGAAGAAGAAGAAGAAGAAGAGAGCGAAGGAGATGAAGAGGACAAGAGCGCGGAGATGCTCATCCGC
GGCTTCCAGAAGGAGGATTCGGCACGGCTCATGAGCGCGCAGGACAGCGAGAAGGTCGTGGAGAAGGCGCAGCACGTGAGGAACCAGAAGATCATCTGGG
AGCGCTGTTTGGAAGTACAGATCTACGCCAAGCGTCTGCTGACAACGGCAAAGGATGTAACGGCACATGAGACGGACGGAGAGACGACGGATGAGGAAGC
AGCTACGAAGACTAAGGAGGAGGTGGTTGCTCAGCTGTACAAGAGCATCGACGCCGTGTCTGCACTGCAGGAGAAACTGTGCAATGTACCTGAGCTGAGT
GCGGGTGACGCACCCACCAAGAAACGCAAGCGCACGTGCGATGACTTATGGCAGGAGATCAATGCTAACAACCGCACGATCCTTCCTCAGTACAACGAGA
TTCTCAACACATACACGCGCAAGACCGACCTAGCGGCAGGAGGCAAGAACAGCCAGGCGAAGAAGTTCAAGGCTGTGAACCAAGATATCCTTGCGCAAGT
AGAGTCGGTGCTCGTGGATCCCCAGCGAGTCAAGCGAAAGGCACATGCGCCGCTTGATGTACCAGAGGACGAGGCCACAGACGGAGCTCAAGACCTGCTG
GATGAGCTCATGTACGACGACTCTGATTTTTACCAGCAGCTTCTGAAGGAGTTTATCGAGAGTGGTGGAGGTGGCGCTGGGCAGGACGCCATGGTGAGGC
GCACTCACCGCAAGAAAAAGAAAATCGTGAACCGCAAGGCGAGCAAGGGCCGCCAATTGCGCTACACGGTGCACCCCAAGCTCGAGAACTTTATGTTCCC
GGAGCCTTACCCCAAGCCGGAGATGGACGTGGACGAGCTTTTCCGCTCGCTCTTCGGCCAGGTTCGGCAGTAGAAAGCTTGACATTGACATGCTGGCCAT
CGAGAAATAGATTGATTTTGATCGGAATGTGGGTGCTTGTAGGCGTGTTAGTGTTTCCTACGTACTTACCGCGGTAAATACCCTTCTGCCTACGCCATAC
GCCGGCGCGCTGCGTCTTGTTCAAGGAAGACATCGCATGTTTCCTTATAGCACATCGTCTTCTTCTTCCTCTTCCTTTTCGCCTGATAAGTACACTTCCT
TGACCTTCGCTACGGTTGCCTCCAAATCCCGGAGACGCAGTTCATTGACTCCGCTGGCGCCAATCTTCTTGACGATGCCCACCAACGTGGCTGCCTTCTC
AGCGACGTGCACCACAGCCAATGCTCGGATCTTCTTAGCTCGAGTAGCATTCTCCAACGACCGGAATTCCTCATCGGCTAAATCCATCGACGCATCAGCA
AGCACTATTGTGGAGTCAAGGAGCGCAGTGCCATGCTCCTCAAAGCGCTCAGGGATGTTGAGCTCGTGCAGTTGCCGTACTTCCGAGGCATACGAGCCGC
TCTTAAATACTTTGTGTTTGAGTTTCACTGTGTCCTTCAGCAGCTGTGTGAACTTGTCGATCAGTTCTGGCTTACCCTTGGCGATTGCACGCATTGTTGC
AGGAGCGTTTAGAATCTGTGCGCGCTTTGCGATCAACTGGCCAGCATCGCGTTCCAGGAACGAAAGCCCCCACAGACGTCCGTACGCCTTGCCAGCATCT
AACCGCTCCTGTTCTGAGTAGTACCAGTCCCGCGTTTCCTTGTTCTTGATGAGCAGACGCGATGACCAGGACTGGACGGAGTCAGTTCCGAGCGCAAGCC
CATATTCCTCCAACTTCGGAGCGATTGCTTTGTAGAAGGTGATCGCTACTTCGTCGGTGGACAGCTTCGTAGTCAGTAGTTCCGCAACCAAGCGGTTGAC
TTCCTCTCGATTGTCAACGAGCTTTTTGTTGCTCTCCTTTCGCGCTTTCTTCTCGAGCTGCTCGATCATACTCATACCAACGGGTCCCTTTGATTGCTGG
GATTCATCACCAAAGATGTCGTCGATAGCACTTTCCGCGGCGGCCAGCTCCTGCGCCATCTGATCCTCTACTGACCGCGGTGGCATGCCATCTATTGTAG
CACCACCGCTGCTCCCGCGACCACGCGCACCGTTCGCCAAGCCACCACCATTTGACACTGTATTGATCCCGTGAACACACGCACACATCAGTATGCAAGC
AAACGACAACAACGCACCTAACAGCCAACTTACCTTGTTGGATAATCTGCTGGTGTTGCATTAGAATACTGAAGAGCTGCTCCATTGAGACAGGGCCAGT
TGGTGAGGCTGGCGCTTGAGCAGGCGGCTGATAATGCAAGCACGATTTAGAACTACGTAAACATTGACAAGACAAACAAGAAAGCTGTACCAAAGTAGGT
CACTTACACCAGGGTCGTTGGGAGAAACGGCATCTGGACGGTCAAGTAGATCGGGATCCATCTCGTCCGCCTTCATTTTGAGCTTGATCTGCTCGTCAGG
CATGCCCATTTGCCGCAGTTTGAAGTACTTCTTGAGCTGTGGATCATCTTTTACAAGAAGTGGTTCGTACGGGACAACAGGCGCTGGAGCAGACATTGAG
GGCCAGCTGAAGCCGCCACTAGATCCTTGGGGTGGAGACAGCGGTGCCATTCCATTCGACGGATATCCTGACGAGATTTGCAACGGTGGCTGCAAGAACA
GAAAACATAGCCAAAACGGTCAGATAACACATGCTTGATGCTTCACAACAGTGGACAAACTCACGCCAAGGTCGTTCGGTGACACTTGATTCGGGTTGTC
CAGCAACTTGGGGTCCACGCCGTCGGCCTCCATTTTTATCTTGATCTGACCCATGGGCATGTCCATACTCTTCAACTTGAAGTACTTCTTGAATGCAGGA
TCGTCCGCCACGGTCATCGGGATGTAAGCACCCTTCTCTGGCTGTAAAAATAATAAATAAACACCAGACCCTGCATAAGTCCTCGTGCCAACAAGACAAC
CTCGTTTTGTACGTACGCCCGGGTCGTTCGGCGACACAGCGTCGGGTGTATCCAACAGTGACGGATTGACGCCGTCCGCCTCCATCTTCGTCTTGATCTG
ATCCACCGGCATGTCCATTCCCTTGAGCTTGAAGTACTTGGCAAAGTCGGGGTCGTCCTTCACCAGCAGTGCAGTGTACACACTCCTCGCGCCTCCTGCG
TACGTCTGCGTCTTCTTCTCCAGCTCGTTGAGCTTTTCGTGCAGCGCCTTGATCTCCTTCAAGCTGGCGCCGGACGCTCCTCTCTCTCTGCTCACTGCTC
CGTTCTTCTTGTCGGCCATGAGCTGGGAGATCTGTCTCTGTAGCTTGTCAATGGACGAGCTGGTCGTCACGACGTCCGCTTTGGACGCCAGCTCCAGCAG
CTTCTTGACCTGCTGGGGCGTGAGGCCAGGGACTCCCATGGTCGCGAGCGGAGCGTGGGCCACGTCTTCGCTCTCAGAGTCGCTCTCCTCCTCCTCCTCG
TCCGACTCGTCCTCTTCCTCCTCATTGGCTGCCTCCTTCTCCATGCGCCGCTTGATGCAGAGGTTGCGGTGCGCTCTCGCATGTCTTCTCTTGCATGTCT
AGTCATATTCCACATAGTCATATTCCATCCTCAGTTAGTGATAATCCACCGTTTCTTAGTCGGAATATATGCTGACGTACTTCGCTGCAGTAGGACGCTT
CGTTGCAGATGGTGCAGGGTAGCGACGCGTTGGGCGTCGCACAGTAGGCGCAGTCCTCGCCCGCCGACACCGCGAAGCCGCCTGCCAGGCGGCTCATGAG
CTCATCGTCGCTGTCGCTGTCCGCCATGGCGAGTGATTGACGCGAGGCTTCTTGAGGACTGCTGCTTTTAGAAACACCAGAAACGGGTCTGATGGGTTTG
ATGTCTCGGGACCCGAAACTTTGGCTGATTGTCCACAAGTAGAACGTGCCTCGGCCATCCTCTCATCAACAGGAATCCAGTTGATCCAGTCTTCTGGATA
GCCGCAGATGGAGTGAAGCCTACCAGAATCAGATCGATTGGAATTCGTCACTTCAACTTGCCTTTTGCCAAATCTTGTGAAAAGAGTGTCATGTGTATTG
CTCTGCTACAATATGAATAAATAGTGCGGCGTGCGGCCATGCCACTACGCTCTTCGACCGAGCGTAGTTGGCCGCGTGCGGCTTATATAGATAGGGTTTG
CCTTGAAAGGAGAGCTGCGTGTCGTCCTCCTCTAGGCTGCAGCTCGGGACAGGCGACGCTGCGAGAGCATGCGCACCATGTCCGAAGACTTGTCGGTCTC
GCTAATGTTGAGCACGTAGTCTGATCCCACTTGCTCGTTGGTGACAAAGCCCGAGAACCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCC
GCGATCATCATGGCGTCGCTGTCGTTCTTGGTGCGCTTCTCGGGGTCGGCGTCGTGGCGCAGCAGAAACTCGGAGATCGCCAACGAGCCCAGTTTGGCCG
CAAAGTGCAGCGGGGTGATGCCACTCGCTGTCATGACATTCACGTTCGCGCCGTGCTCGACGAGCAGCGAGACGATCTCGATGTCTGCGAGACAATGGCG
GCATGAAGAGGGTAAGTGCCGCGCTTGCTGCAAGCGGATACCTTGGCACCAGCCTCCAGTAGCAGCTTCACGACGTCGACGCATCCGTTGCGGCACGCTG
CGATGAGCGGGGTCACACCAGCATCGTTCGCCTTGTTGACGTCTGCGCCCTCGTCCAGCAACAGAGACACAACGTCTGTGCGTCCCATGCGGGCCGCGAT
GTGCAGACACGAAGACCCATCGGCCATGGCCGTGTTGGCGTCGGCGTAATTGAACAAGATGAGCTGCACGGCGTACAAGTGGCCGATACGGCACGCCACA
TACAGACAAAGCTCCCAGCGGCGAGCCTGGGTGAGCTCGGGTGAGCGCAACTCCTCGATGTCGTTGGCGAACTGGTTCAGTACGTGCTCGCAGAACTCCT
CCATGAACGAGTGCATGGTGTGGACGCGCACGGCCTTCACTTGCAGGGACGGGAGCGTCATGCGGTCAGGTTCTACGTCGTTCTCTTCACTTGACGTAGG
CGTCGAGTCCTCTTCCATTCGAGGCTCGACAGCGCGTGGAGCACCAAGATGCACCTCACTTAGCTCAGGAACGCCTTCCTCTTCTTCATCTTGGCTAAGC
ATCTGCTCGGCGCATTGCTGCCTCCACCCGTTCAAGGCGAGCGGGCGGTGCAGCGCCGCCGAGGCGTCGGTGGGGAAGTGCTCATTGGCGCCCAGGAAGT
TGGCATACGTCTTGAGCACGAAACAGCTGCCGTCCTGCAGCTTGTCCCGCAATGTGGCACTGGTGAAGGTGCCAAAGAAGTCGTGTAAAAGCGTCACGAA
GGCCGCGAACGCATCACGGCGCTCATTAACGACGGCATGGTCGAGTCCCGAGAGCTTGGAGCGCAGTGAGCAGCGCGACGGGAACGGGAACGACCGCAGC
AGCGGGTACAGGCCGTCAAACTCGCAGTGGTCCTTGGCGCAATGGCATTTGTGCGCGAGGCTGAGCGTCAGGTGGTGGCGGTGCTTCGGCTCGTTCACAC
GCTCCCGCAGCGTCTTCCACAGACGGCGGAACTGTGAGTACGAGCGTAGCGTGGTGCACACGCCGTTGGCATCTCGCTTGGTGAGCTTGAGTGCGAAGAA
GACTTTGCCGTCCGTGACCTGGTAGGAGGGCACGGCCACGTCGTACTTGTGGACCCAGCTCATGTGTTTGTCGAAGGTGGTGTCTTGGCGAGTGGCTGCG
ACGGAATTGGCGACAGGGTTGCTGGCTTCTAAAGGTGTTCGGATGGTTCTCGGTGCGCCGGTCTTTCGAGATACGACCGAGCTAGTAATAGCGAGGGCCG
GAAATAGAGTCCCGAGGGGATTCGCTGGGTTGGTACGAGCTCGCTGCAAGCAGCAGAGCTACGTGGATCCTTTTCCGCGTTGGAAAAATGGGAATTGGTC
CAGTGCCGGACAAGCGCCAAGATGCGGCGTGAACTCGACAAGCATCGTCGTTGATGAAAGTCACACGCGGTCTGATCTACCAATGGGCGCGCGTCAAATC
CCCTATTTTGGCCAATGGCCATGCGGTCCCCCTTTCACAACCGAACGCAGAAAATACGCGTGTTTCTGCCCCGGCATTAGCTTGGCTGGCATTCATCCAC
GCTTGACGATTTGCACCGTCGGCGCGGTCTCCGATGTTACTGCGCGTCACCAACACTGGTGCGAGCTGACCAGGCCGCCGCAGTCTGCATGGAACGACGT
GTGCAATGCAGAACACAATTCCCACTGCAATCTTCCGTGTCACTTCCCATTGCTGCACGCAGCCCACAGCCCTGGGGAACGTACACCGTGAAGTTTGGGG
ACGTTACCAATTCGGGGGAGCACAGCTAAGAATTGTCAAATGCTCGTTGCGATCGCGACAGCCGATGGATTTTCGCAGCGTCCCCAGCTCGTGGGCTTTG
TGCACGTGGGGTCAGCAGGGTTGAGCCCCCACTGGTCAGCAAAGTTGAAGCGAGCAGCATCAGCGAGATCCGTCCGGTGCACCATGCAGAGCTCCGAGGC
CGTGAACTGGGCCTGCAGTAGTTGCAGTGCCTCAACATCCAAGGCAGTGCTGGTGATGCGAGCCCCCCGGGTGATCGCAATTGTAGCCCCACCGCTAACG
ACATTCAATTCCTTAGCGGTGGATTTTCATGAGCACCATCCGAGCGTTCGATCGTCCGTGCGACTTGTAAAAAATTCGTATTGCCGCAGACGAACGGCAG
TGTCGTGTTTGTGCTTGCAGAGGATTCCGACACAACGTAAAGGCAGGCTTTGCACGGACACTTGGTCGACGTACATGTACAAGCGACTCCACCTACAGGG
TATCCTTGAAGCGGAGGTGTTAGCCAATGCAGTGATGCTGTAGAGTTACAATCAAAACGGCGGACCAAAAGAGCGGTTTACAATCAAAGTCGCTCGAATG
ACCTTCTCCATGTAGCTCTTGTGTTTCACCAGGAAATGAGAGAGGGGCGAATCCTAGCTTTGGCGCACAATCGGTATTGAACTTCACCTTCAATTCGGAG
AACTCTTGTCATAGCTCCAGTTGAAGTTCGCAGCAGTTGGCAACTTGAGCTGCTTCAAGCTTTCGCTGCCTTCAAGAAGTCTTGCCATAAGTTGCTCGCT
CGGCTTAACTGCTTCCTGTATTGTGGCTTCTGCTCCATCGTGCTGGTGACTTCGAGCTCACAAGTGCCAAGCTACTGGTCGCGTCTCTTCAAACATTCGA
GATCCCTCATGGGAAGATTGGTAGCTGCGGTATGCTGCGCCATTGCTACGACTGCCGTGATCCACACAACCGAGGCGCTCGCTTGCAATGCTGGCACGTA
TTTTGACGGCACCAAGTGTTCGCGATGCCCCGGAGGCACCTTCGGCTCCACACCAGGACTCACTTCATCGTCGTGCTCCGGACAGTGTACGGGTGGGTTC
GTTTGCCCCGAGGGGTCGACCTCACCACGAGAAAAGCCTTGCGGCACCTCCACCTACTACTGCCCCGCAGGGAGTGGGGAGCGTCGGAGGGTAGACACGG
GATACTACACAATCACGTTTCCAACCGATCAATACAGCTCGAAAAGTGGTGCAGGACAGCAAATACGCTGCGAGAAGGGATACTACTGCGTCTTCGGGAT
CCGCCGAGCCTGTCCTGCTGGGGTGTTTGGTGAATCCACGAGACTCACAACCCCAGCATGCTCTGCTCCGTGTCTGATGGGGTCGTACTGCCCCGAGGCA
ACATCCGTGCCGATCCCATGTCCCGCTGGAACCTATGGGGGTGAACTTGGTCTAACCAATGCTCGATGCAGCGGACTCTGCCCAATCGGGCACTACTGGT
ACGTTTTTCAACTTGCAGCGTGTTGATACACTGATATTTACTGATTACTTTGCTTGGAACAGTGAGAAGGGGACAATCGTTCCGGTCGCTTGCCCTATTG
GGATCTATGGAGCTACACAGGGTCTCATGACTCAAGCATGCTCGAGTACATGTTCTCCAGTCAATGGTGTGCTTTCGTGCCTTCCTTCACCATGCCCACC
AGGGTTTTACTGCCCGCTTGCGGCAACAGTGCCCTTGGAATGTGGAGCAGTGAGTCAGTTTTGCCCCAAAGGCTCTCCACTGCCAACCACTGCAACTCCA
GGATACTACACGACCTGGAAGGCGTACTGGGGGACGACCGCGACAGGAGAGCAACTAGCCCTGCAGTATGTTGAAGGCAGCCAACTTGCCGTTCGGAACC
AAACCACTCGATCAGATCAGCACATTTGCGAAAAGGGGTCATTCTGCATTGGTGGCGTCAAAAGGCTTTGTCCTGCTGGAACTTACGGTGACAGCGAAGG
TTTGCCGACTGCAACTTGCACCGCGCCATGCCCTGCTGGCTACTTTTGGTAGGGACGTCAACGTCCCCGCATTCTTTCATATCGTCGTGGTCTAACGGAT
CTTCCCGTGTTTACTTTCAGTCCGGTAGGAACGGCAAACTACAAACTGCAGCCGTGTACGTCGCGGGCATCATTTTGCCGCCAAGGCTCGTCAGTTCCCA
TTGCTGTCGCCACTGGGTACTTCACAGTCGCAACACAAGCAGGGCTTCGACCAGACGAAACAAAATGCCCAGCTGGAAGCTATTGCACCGCTGGTGTTCA
ATATCTGTGTCCTGAAGGCACTTACGGAGCCACGCCCGGTCTCGCGACCAAGACGTGCACGGGCAAATGCCAGGATGGATACGTCTGTCCACGTGGGTCA
ACGTCAGCGATGCAATCACCTTGCCCGGCAGGATCGTACTCGCGAAATGGCAAAGTCTGTGCAGCCTGCTCTCCTGGGTACTGGTGCGGTGTTGCATCTC
CGGACCCCCAGCAACACGCCTGTGGAGCTGACAATACGTTCTGTCCTCTGGGGTCGCCAGCTGCCCAACTGGTGCTTGATGGCTATTACGCTGTGGGACA
GCAACTTAGTACACACGCGTCGGAGGCGTTGTGTGTACTTCGCGATGCCCCCCATCTTCCACAGTGTCCTACAAGAACTATAGGAGTGAACGGTAACCTT
TAAC