Description :
From Genome Similarity Track
Location :
Scaffold_25:231710- 239774
Transcript NameFunction/comments
Phyin_T30-4PITG_12921Putative uncharacterized protein
Phyin_T30-4PITG_12922Putative uncharacterized protein

Sequence
8064 bases(100 bases per row)
TGCGCGTGGAGGCTGCGTACGAAACCCATGAGATACGCAACGTCATTGGGCTCTTAGTGGCAAGAATGCTGAACCCAATGACGCGTAGCTTATCGCGGCA
CCGAGGACGGTGCAATACCTGCCGGCAACGTTGGCAAGTTCACGGCTCGAAATCGCTGCACGTCAATTTCTCGAGACTTCCAATGTCGTGAGCAACAAAG
CCCCATGGATTCGAGACAAATTGTCGAAGCTACGGCCTGTTGTCGCCACGTTGCAAACTCGGTTTCGAGCTGCTTGGTCACTCGGCAGTAAGCTCTCGTT
TGACGAAGGCGTACTACCAGCCACGCCCTAGCGCAACACCACGCGGATGTTTATGACCGACAAGCCCCACCGATACGGAACTAAGTTGGTTATGGCTTGT
AATTCTGTGAGTGCATACTGCCACCGATAAGTTTGTTTGGTTTAATAATTATGTCGTAACTTTCGGGTTGAATTATAATAATAAGAATATTTTATTACGT
CGAAACTTACTACTTTAGATTCGAGGTGTACGTCGGAAAGCGTGAGACCGAGTATGGTGATCAGCAAGCAGTCGACGAAAAGACGGGGACTGCTGCAGTG
ATTCGAAACATGAATGCCGTTCTGGGAGACCGATCACAAGGGCTTCGATAGATAGTAATCGACCGATTTTACTCTATTCCACTGGCTATTCAGTTTCTAT
CGATGAATATCTATGGGGTGGAAGCGATCATGGTCAACAGACTGGGGCTCGGCAAGCAAGTTATTAAAAAAACTTAAAACACGTCCTCGAGCGATTGATC
GTGATACTTTTGCGTTATCTCGCTCCGCCGCGATTCCGACTATGATAGCTGGCCACTGGTGGGACCAAAAGCCGGTCCACTGCCTGGCCACGGGTCCAGT
CATGGCAGAGGACTCTATTCGTCGCAACTTCAAGATGATAGGGCCGTCTTGCGTCAAATGCCCAAAGTTGGTTACTGATTACCCAAGTTGGATGGGCGGA
GATGATGTACATGATCAAATCCACCTGCAGCCCTATTCAACCCAAACGGCTTTCCGTTTCAGAAAGTATTACAAGTCACTGTTCATGGGTTTCATGGACA
TGTCAGTCATCAATGCGTGTCTCACACACAAGGAAACATGCCGGATCAAGAGGCTGGTACCAAAAGATCGTGGAGAATGGTATATTCTACTTCATAAGCA
ATTGATGCAACTCAAGCCGACGACTTCATCGAAGCTACTTCCCCTACACCTTCTCCTATGGCTTGCTCTCGCAAGCGCCGCCGAGTAGACGGGCACTAGC
ACATCTAGTTCAACGATTGGGCCACCGTTTCAGGCATCCAAAAGCCCCGGCAACGCTCTTGCGAAGTATGCGCTCTTCTACGAGGGGATCGAAAAAATCC
TTTCAAACAACCTATTTTTATTGTGAGGATTGCTCACACGCAGATGCAAAGTGCTTCCTCTGCCCCAAGTCGCGCCATAGCTACGGAGGCGTGCGCAAAA
CATGCTATCAGATTTGGTACGAAGATCTTGATAGTGGGGGCTTCCATCCCAGCATCGCTCGGCAAGCGAGTCGTCTTGCGACGATCAGCAAAGGCTGGCA
CCCGAAAACCAACTCGGCGTAAGCTACTCTGTCAGCAAGACGGTGAGGCCGATAATGAAGAGGATCAGCCAGCTCATTAATCGGCAATCGTTTGAATGCG
TCTGGACAGCACTTAGCTTATGTAAATATAGTTCTTTCTCTGTTGTACCAGGACCTCTACGGATGTGTAAATAGTCATCTGCTTCGACAAAAAAAATTAC
TTGAAATTCGTAACTTATGGCTTTTCGTGATACGACGTAGCTCAGAATATCTTCTGACAGTTTATAGCGGGAATCCAGTGTGGATAAGACACATCCATAC
AAATAAATATACTAAAATAAAGTCGGTGCTTACGACGTAAAATAGGAGGGGTTAATGTTTAAAAATATGAAGCTAAAAAAAGAGACCAGTTTACACAGAG
GCTATATATGGATCGTAGTCGTGAAGTACCTCGTACAAACCCTTTAGAATGGTAGGGAGTCATCAAAATGCTCGACAGCGTCTCTGGGAGGCATGGATTT
CGCTTCAAGTGGAGAACCAAGGCAGCTATTCGATTGAGCGGATTCGACAGCTTGGATTCTACATGAGCGGCCTCAAAAATCGACGAATTCTACTGGCTTG
TGTGCTGACTCCACTGCCGTGCCTTGTGTTGAGCTTGTTAAAACAGATACCACCACTCTCTCCAGCTGAAGCCGGAGTTTACAAAAATGGAGTTTACATT
GCCCGATCATGGGTTATACTCTGCTTTATGGGTGCTTCAACGCTAGTCCAGATGGGCCACGGAGCGCCTCGTCTTCAGTTGACGAGGCTCCAGATAACTA
GGGTTTCAATACTGGCAGCTACAGCTTCCGTATTCGGTCTCTGCGTTCTGACCGTCTTTCCGCTCCCGTTTGGCTTACTTATCGCAGGTCCACCTTTCGT
TATCGTGATTGCTATTTGCTTCACATACATCTCTGGACCCCAATGGAGAAGTGATCCTTCGATCTTGGTGGATGTTAAGAGACAGCTCGTCATTTACAAC
TGCCAAACGATGCTTCCCTTTGTGTATCCTTTGTACATATTGGGTTTTGTATCGCTTACCGGCATGCATCAAGTAGTTTTCGTCGCCGTCTTACCGATTA
TCCAGATTATCGCCAAGAATTGGATCAGCCGTGCACTTGCCGATGATGACCAAAAACCTCAGTCTGTCGTCTTCGTCGTTGAAGTTTACAACGCTCTTTA
CGTATCGAATGTTCTCCAGACCGCTTCTTCTTGGACATCCACAGCAACGATCATAGCAGTAGACCTCCTCCAGTTTTGGGTCTCAATGATTGACATCGTC
AAACGTCTTGACGAAGTGAACTTGCTAATGCACAAGATCCCGCCAGAACACCCGAGTGCAAAGGAAAACTTTGTCCAAATAGCTGTCCGTCTATTGAATA
TTGATCAACATCAACACTGCATTGATCCAGCGATGGCTGGCGACAGGAAATCGTCCACAGACGTCGCGAACAGTAAAAACGACAGCAATAAAACCACGCG
GGAATCGTGCAGAGCAACCTGCCAAGATGGAAGCCGCAAGCAGAGATTTATAATACTTAAGAAGACACGAGTTCTCCCTGTTATCGCACCTGCCAGGCAT
CAGACCAAGCATCATCTGGCTCCCATTATAACTGTGGCAGCGGAAGACCCACAGGCTAAGTATGACAGACTTGAACTGATATTCAGTCGGAAGGAACGGG
CTCGTTTTGTCCAAAGAAGCGCTCATCTCCTCTTCATCATAGAGTATTTCGTCCTGGTGGAGTACGTCGAAGTGGTATTGCCATTCATATACTGTAAGAT
GTCTAGCGTTTACAAACGCTATTGGACATATCGATACTAATGCGAAGTCTTACACAGGTCTGCATCAGTTCATACTATTCCACATGCCCAACAGTGCCCA
TTACCCGGCATTAGCTGGATTATCGAGAGAAGAGTTCACGTCCAAAATGCTTAGCACACTGCTCTACAGCTGCTTCGAGCTCGGCTCATTTGTTATGCTG
ATCGTTGTGCTAAAGCGCAAGCTCGGGTATTCCAGCTTGCAGCAGCTAGCTTTCGTTCTGGATGTGTATGCCGGTATCGTTCAGACGAAGCTGAACTTGG
TATTCGTCTACATCATGCAAGTGTCGTTGGATCACAACGGTGAGTGTCTTGAGAGCTTGTAAGAACTGAATCGAGATTAACAAACGCTTGCGTGTGAAAG
GTGCCGATTTCTCGTTTAAGCTCGCGTGGCTAAACTCAAAGCGAATCCACTGACGTCTTGGTGAATAAAAACGCAAGGCATAAACTCCCAATTCCTAATA
CCCTACCTAAAGTAGTACACGGGAATCTGGAACTCTTACTACTTTTCTTACCAATGGGCTCTTGTATTTAAAAAGCATCTTTCTGTTAAAAGCGCTTACT
TCGATCCAATGAGCCTGCGCTGATTCTATGTCGTTTCACTGGAGGATTTTTATAGTTTCTCTAAGGACCTGCTTTAAATAGGATCTAAACCAGAAAAGCC
TTGGCACAGAAATCGTTTTCCTGGAGAATGTTCAAATATTACTAGTATGGCAGCATCCTCACGGCGATTGGTCGCCACGGTTGCTAAGGGGCCAATACCG
AAAAATTTATTATAAAAAAACTTTTGGGCACCGCCCCCCCAAGCATCATATGCAAATACATAGGTTGGAGCACAACAACAATTTTTTTCATTTTGAAAAG
CTACAGTTGACAGGCCCTTGTTGCTACCAGTTGCGTCGCTACAGAGGAGGTAAGTGTGTACTGCTGGTGCGGTGAACGTCCTGATACGACAGCACTCACG
CTATGTTATGCTGTCAAGATATTAGCTGTGCCAAATGCCGAACAAGGTCCACGCTAGGGGCTCACAACCAGAAAGAAACCTCAGTTCAAACCAATGCAAG
TATCCTGGTTATTGTCGCAACAAGAGGGCATTCAAGAGGAATGGAGAACGCCACTGGCTCTGCGCTGAACATCGCGATCATCAGAATACTATGCAGCGTG
ATCGCTACCGGAAAACTACTAAGAAGGATGGCAAGAAGGAAACAAAGAAGAAAACTACGGCAATCAAAAAACGGAAGATCCAGAGTTCTACGTCTTTGAG
CACCAAAAAAAAGGGATCAACTCCTGCATCTACGGCTTCGATTGAAGATTCCTGTTCAAGCACAAGCCGTGATAACGTAGTTGTGGAGCATGTCGAGCTG
GATGTACCTGCGGTGAGCAACGCTCAGCGACCACGTGCTGTCGAAGGTGTTAAGGAGAAATCATCAGGGCAATCAATCCGTGAAGACGAGAATGCAGGTT
CTGCCCTAGGCGGGGAGGTTTCGACGCATCGTGAACATTCGCCTTGCCTGTGCCACAATTCTCCTTTGGTGCAGTCTTCCCAAATGATCTACATGCTAGT
TCCGCTACAGATTGGGGCATCATTGCCGTTATGCACGGCTCAGCAACAGTCTATGATGCCGGCCTCTGTGGTGGTTGCACCAGGAAGTTTAGGTGGTGCT
ACTGCAGTCTCTCAAGTTCAGCATGTAATGCTACCGGTATCTCAAGTCCAGAATAACGTCACCTCATCCCAGCGCGCCTATGTTGTGTCTGCGCCACCAG
CTCCAACAAGTACGTACTCGCCGCTTATTCTTTGAAGATCATCATGTAAGCGGCTACGTCAACTAACTGTGGAATGGCTTTGTTGCATTAGAGCAGGGTG
GTGAAACTGACGCTGGCAATACGGTCAGTATTTGAGGCATGGGAGCTTACTACGTGTTCTTCGCGTGCTGTGATATGCTCTTACGATTTTTAAAGTACTA
CGAACACAATAATTCATAGGAATAAAAATTATTTTGATTCAAGGTGAATATTGTTCTACAGACGGTTTATCTAAAATTGACGTAAACTTGCACTTCATAC
AGGCAAACTTGCACATTTTTTTTTGCAGGAAAGAGCAAACCAAGCAGAGCTCTTACATACATGTAGTAAAACTCTATTTCGAGTTGAAAATCACATTTTC
ATTAATTGCCCAGCGATATTATGTATTCTTGCCGATACTGCAAATACAACGAGTCATAGCCCCGTTAATACGCAGACTCCAGTAGTTGATACAGTGCGAA
TGAACGCTTGTGGATGCACTGGTTACATTGTTTAAACTTTTTTTGTTTGGTGACGTTACATTGACGCCACTTAGTTAGACTAACGACTTCATAGTCTTAT
TTGAATCTTCACTCAATTTCCATGTCCTGTTCGTGTCGTAGCCCTTGTTTGCCAGCAGTCACGATCAACCCGAAGAGCTTAGTTTTACTTAAGTCCTTCG
AAGTACAGCACTAGAATCTTGCTTCCACCCAGGTATGCGCAGCCATCATTACTGCAGCAATATTAAATTGCTTTATTGGAGTCCCTAAAACAAAGCATGT
TAAAAAGCCTCGTTGCTGTCCAGAATCACAAGCTTTCTCACCTCTTGTAGTTCTCGGGGCGACAAAGTTGTCTTTTTCTATTGCGTTGCGCTACGAGCTG
TTTTGGCGCCTCGAAAGCCATTTTTCGTAGTTTTCACCTTCCTATCATCTTGGTGTGATGGTGCTGTTGTGGGCTTGCGCCACCGCTTTCATTCTGTCTA
CCACCGACGAAGCAGCTAGCGTCGTTTGGGGACAGCTTTTAAACCACGCTGCTCCTCACTTCGGAAAATTGCTAATTGCTCGGGAGTAGCTGTGAGTCGT
TCTAGTGTCAGCGGCTGTGTAATAACTATTAAATTTCGATGTGTTATACGTGAAAGGGCTACGTATGCAAACGAAATGTTTGGAATTGCATTAGAGTGAA
AAACCACACACGAGCATGTAAGCCCTTGTACCTTATGCACTGTCATAGCATAAGCCAATCGAAGCGGAATTCCCCTTCGAACAACGCGAAGATCACTGGA
TGCCTTTCCCCAAGAAACGTCTTTTGGTGGTATTGGAACGATATTTGGTACTTCATCTAGTAGGGAAGGACCGATATACGGGTCCGTGACTTGAACGAGC
ACGATGGTAGATCGCTTCCCGACACAAAAAAGAAGTCATAAACGATCGCATTTGTACCATTGCACAGACCTGCAGCTTGGGCAATGTTGTAGGTAAGTGT
TATAGGTGCACCAACACACAGTTTTAACCTGTTAGGCACCACTCTGTCATGATCAGCGTTAGCTGTTTGAGCGTCTGTTAGAAGTGCGCGAGCGGTTCCA
GCAGGTATGTCTCGTTTTGTCGTTAAACGTTTTTGTTGAACGAAATGCTGCGAAGTTAAATGCACAATCGGTACATGAGCTGATACTATACTGTGATCGT
TGGCGTCATTAACATCTATATTTTTGTATGCAATATGTTTGGCATTAGCCATCCACTTGGGTTTTCCAACAAATTGCACTGAACGGGAGTTGAAGAAATC
AATGTCATCCTGGGTTGGCGATTTTTTACGTAGACGACGAAGAGCGCTAAACCAGTCAGGATCTAAAGCTCCTCTATTTTGACTAGTTAGCATACACACC
GTTTCAATACTATCCCATATTTCTTTCCCACGTCGCTGAACCTGGTTTGAAATCTTTTGAAGGGGTGTTGATAGTGAAGTTGGGACAACGGGGTCTAATT
GAGCAGAATCTCCAGTAAAGTACACATCTCTTCCACCAAAAAGCTCGTTTGAGTTGCTTGGCCATATTTCTCTCATTCTTTTATCAATCCAATATAACAT
GCCGCAGGATATCATGCTAAACTCATCAATAATAACTAGATGTACGTCTTTATATTCTTCCTGCAATCGTTTCAGCTTTGTTGGGCCCGTTTTCGAGTCC
GTTAGAGATTTGTAGGGAATTGAGAATGAGGACTTTGAAAACGATGAAAATGAGAAAGCTGAGCACAGTGTCATTCCTTTTATGTTAAATGCAGCAGTTC
CTTGATGAGCTAGGAGTAGTTCCCGTTTTGATTTCCGTCTCGTAGCTTTATGTTCACCAAATACGTTGTGCATGTCCTTCACTATATGGCGAATTAGCCA
GCTTTTCCCAGAGCCACCTTCACCGTTTATAATCATTTGGAGAGGCTTACACTTAGATTTATCCAGCATACATGTAAACCGTCTTCTCGATTGTTCCATT
GCAATTGCAAACGGAATCCACTGCGATTCAGCCATTTTTTCGGTATTAACTAGATTTTTGTTATCCGAAGTAGGGTATTGATAGTGCGATTTCAAATTTC
CAGTTTGACAAAAGCTGGTTCCTAGTGATCGAGATTCTTTTTTCTTCTTCACCCATGGCTTTAGTGATCCATTCAAAAAGTCACGAGCTTTATCAATGAT
GGCAGACGTGTAGGTGTGTTTGGCTTTCCACTCCATCGGTTTATTTTGGTTTACTGAGGTTTCTACCGCACCCATCGGCTCTGGTTCTAGCATTTCTCCA
TCAGTATTCGATACAAACACATACTCAGACGGAGGCAGGGCAGTTATACTTGATTCGCTACGAG