Description :
From Genome Similarity Track
Location :
Scaffold_152:23171- 24328
Transcript NameFunction/comments
Phyke_g5304transmembrane protein, putative
Phyke_g5305hypothetical protein PHYSODRAFT_248298

Sequence
1157 bases(100 bases per row)
GGGGATTTCCTTGTGTAGACTGCCACATGTCTGTAGTAGTCTTGTTACCAGCCATTCTCCACTCTCAGTCGGTGATGGTGCAATTACTCTTTGTGTTCAT
CGTCATGTACATTGCGTGCTGCAAACTACTGCTGGCTACCCGCTTCGTTTCGCAGGTACTGGGCAGTTGGCTGATGGGTTTCACGGGCATACTCATTGGC
AACCACGGACATGTTGTTGTCAAGAGCTACAAATTGACCCGAGGTTACAGGTAAGACGTATGAATGCATGTTTGCGTCGGAGAGTGGGGGTTAACAATTG
GGCCTGATGTGATATTGTACTATAGCATTGCGGCGATTgtagcgctgctggtgctggctaTGATCGTGCTTGGCATGTGGATCGAAAACAATGATAGTAG
TCTCATGGGTATTCCGAAGCAGGACTTCATGGAAGTCTTTACAAACATCCTCAATTCGGACGCCACCAATCCTGCACCCACACCTCAAATTGCTGTCGGA
GCATCAGCCCGCGTACACCAGCTTCCCAGTCGGCAGCCAGCGAGTTCTACTCGCCAGCGTGCCAGTCAAAGGTCcgtggacgacgaagatggcgacgagg
AAGTAATAGCAGGCAAAAAGGACTCGTTCTATTTCTTGATTCGAGGAATGCGCGCACGTCAACAGGCTGCCCGACAGGCTTCGTAGGGGGAAGACGCGGT
TAGCAGCTCAATGCAGGTCATCTAGGTTTCTGTGTACAGCTTGAGTGCATCCTCCACCTCGCCACGCATGGCCTTCGATACCCGCGGCAAAATCGAGCCC
TTCCCGATCCAAATATTCATACGCACTAGTTCGTGCACCTGCAGTCGAACAACCGCTGGTCCCACTGGCATGTCCGCCAAGGTAGCCCGCAAATCTGATG
ACAGTGAGTCGAAAGTCACGTGCTGTTTCGCGTGAAGAAGACTAGAGAAATCAGAAGTCGAGGCAAGTAGCCTCCGCTTGGTAAAGAAATCGTCGAAGAA
ACCGAGACTCTCCTCCGAGGGTCGATAGAAGATTTCGCCTCGCTCCGTCACCTTCGTGAACACCTTAAGTCCTGTGTTGACAATCTGTTTGTGTGCAAGC
CGATCATTATACGCGTGAGATAGTGCAAGACATCTGAATGAGACTAACAACAAAACG