Description :
From Genome Similarity Track
Location :
Scaffold_1663:2317- 5127
Sequence
2810 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGATCAGAACTTGGAACGGGTGGAGACTCGTTGGATCGACTCAGCACGCGTTGGCGGAGCTAAGGAACAGGATCGCGACGACGTCC
ATCCTCCGCTTTTTCGATCCCGGAACGTCAACCTACGATGATAGTGTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGAGGGGATC
TGTCATCCAGTCACCTTCGTCAGCCGGACTCTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATC
TGAATTACAACCTGCTAGTGGGAAGACCCATCCGGATCCTGACTCGACACTCTACGCTAGCGTGGTTGTTCAAGTCGGCCGGTTTACAAGGACGGTTGGG
ACAGTGTGCAGCTTTACTCTCGCCTTGGCCACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTTTTGGCCGCGAGCATCATACCT
CGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCCGATCCAGATCCCGATCCCGACGGTACAAGTGGATGAGGATC
TGTACGTCCTGAGCTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCAGACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGC
CAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGAGTATAATGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCTGAAAAGGTTG
GTGATTTGTGGAGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCC
ACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGG
TGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATCTCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGAAAGTCCAGGTG
ATGGCCGTCACTAGGTCCAGAGGACGGATTGGATCCAACCCCCACATTCTCGGGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCAC
AGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGGGATCTGAGTCGGGAAGATGCCAAATCCTACAGCGTTATCGCTAC
GGATTACGCGGTGGATCTGAATGACTTGCTCTACTATTGCCTCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAA
ACCTTACAACAGGATGTCCTACACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGA
GGGGACTGTTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGAGGGGTCACCTGGGAATAT
CCAAGCGACT