Description :
From Genome Similarity Track
Location :
Scaffold_970:2317- 4567
Sequence
2250 bases(100 bases per row)
TCGCAGTGGTAACGACACAAGTGATTGTCAAGNNNNNNNNNNTTGCCTGTGCCCCGAAGCAATTCCAATGCGTTGTTATTCGCTGTAACGACCCATGCCC
GACCTCGTGGTGGTGTCATTGGTGGTATGTTTGCTTAAAGTATTAAAGAAGCTTACTGCTTTGTGGATGAGCAATTATCCATCACACATATGGTCTGTGA
TGCTATGGCAAGCGCACATGACAAAGACAAAACAATATGCAGACCAAATTGGTTGCATAAATAATGAATAATTTAGTGTAGGAGACAAAGTACTGTTAAG
CACTAACACTCTACCTTAATATGCAGTTTCAGTTCTACCTAATGGTACTACTAAACTATTGCCACGATTTCTCGAGACTCTTACCGTGGTTAAGGAATTC
GGAGACCTAAATTATAGGCTCAACCCCACACATACATGAAGACATACCCCTTATTGTACATTGGTCGTCTAAAGCGATATGTAGATTCACAAGAGATCAC
ACGTCCGCATGGGTCTGACGTGAGCGATCACGTCAATGACGAAGCGACGAACGACGGTACTGTGGAGGGGACGGCGTAGAGGGAATACTCCTAGCCGATG
AGTGAACCCCGACCATCGTCGGTGTTGGTGAACGAGAAGTACTGCGCGTCGAACGTGCGTCTCTCATCAACAAACGGTCCAGAAGTTCGACCCGAATCTT
CAACCGGTCGTACCATTGACGTGCCTTNNNNCGGACGTCGTCCAAAGTAGATGTCAGTCGCGAAAACTGACCCTCGAGAGCCACGATCCACTTCTCGAAA
GCCGCTTCATGCGCTTGCGTCTGGTCAGTCGACGTGTGAGCCGCGAATAGAAGTGCATTGTCAATGCTAGTATCGGACTCCACCATCACTTGTGAACGCT
GAAGGGACCCAACGCTTCTTTGTAAGAAGGTTGATAGCCCACTATTGAAGGAAGCATAGCTTTGAATTCTTGTCCAAAATGGAAAGGGTATCCAGGGTTT
TGACTCATGGGAGCCAATCGACGCGTTGCTTGTCGAAGTGACTGGGCTGGTTGCCGCTTAAGATCAGGCACACCATCTGAACCTGTTCCGCTAGATCCCA
ACGGACTAGCGGATGCAGCGTAGCGATAAGATACAGGGGAGGGTATATGACCACCCACTTGCTCACGCGCACCCTCCAGCACGAATTTCATTCTTTGCGA
CCGCTTTCTCGCCGGCTTAGGGTGTGGCTTGGTACTTTGCAAGAATGATGATTCGTACTGGTGGGTTGTTTCATTGAGAAAAAATACGACAGGAATTGAG
AACGTACAGCCAAGCCTCTTTCCTTCTTCCTTTCTCGTACGGAAGACGCCATAAATTTATGTGCGTCAATAGTTGCACGCGCTGGAACCGGTGAAACAAA
CCCATCCGCCACTGGCCATTCGGTTGGAGGTGACATCGGTGAGATACTACAAGATGCATAGCGGCCTCTAAATTGGTGCGCTCGCGACACAGATGGACGG
AGGTCCAGTTTACTTGTAGGAGCTTTATGCTCTGTTCGTTGAAGTCTAACTCACCATTGTGGATGTACTAATGTTCGGACCAGACGTTTTAAATTCAAAG
AAGCTGCTGATCCTTAAGGATAGAGCTCTCTTTAATGATCGTCGAGCTAATNNNNNNNNNNNNNNNNNNNNNNTTGTTGTTGGTAGACTGTGAAATCACC
GCAACATCACTACAGTTATTTACAGGTGCGGTTTGAGCATCGGGGATAGGATCAACCGACTTATCCCGTTCCACACATGCTCAGTGTCTTCATCATCCAT
TCGTGACGGCAAGGCATTAGACTCATTCAATTTACCATGAATCCAGAGTCATCCTCCGCATTGGATGCGTGATGTGAACTGTCGCCGACTTGTCGGCGAC
GCGAATGCTGTACTGACATTCGACGTCGTGGCACTAGTATCTTGTGTAGTCTTCGTTTCATCGCGACGCACAATCTTCGTAGTAGAANNNNNNNNNNTTG
GAGACGACTCAATCTTCTTTCCACGTTCAGATATCATGAGAACGCCACGCAGTGACGCTGAGAGAGAGCACACTTCCAGGAAGTTCGTACAAGCAAGCAC
AGATAGAAATTGGCAAGTCTTTGACGGATCACTATTTAATGCTTCTCCTTCGTTGCGATATTTACAGAATTCGAACAATCATTTTGGAAGGAGGGGGTGG
TGTAACGGGTCAAATCGTTAAAAAGACTTTTCGTTTAAGACAAGGAAAGA