Description :
From Genome Similarity Track
Location :
Scaffold_51:231618- 235185
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15721ATP-binding Cassette (ABC) superfamily

Sequence
3567 bases(100 bases per row)
AAACCCATTGAGCGTCACTTGCAGCTTGGCGTTGTTCTTGGCCAGACAATTGTTGTTGAAGCACGGCGTCGAGTTGCACGTGTTGCACGGATACCACGGA
GACGCGACGTTGGCAGCGTTGCAACACGCACTCACGTCGCAGTCCACCACTCCCAGTGTGCAGTAGTCGAAGCCACGCGAACTCACACACGCCGTCACGT
TAAAGTCCGGGTCTATCAGACTCGAAAAATTAGTAGACGCAGCGCATTGACTCTGTTGCGACTCAGTAGGCAGATTTGAAGCGTAGTTCGGGATAAAATC
CGCCACTTGGATCTCCGGTAGAATGGCCAAGATGATCAAGAAGATCAGTGGGATACCCACCGAGTACGCCAACGTCTTTTTGTCCCGCTTGGCAATCTGG
AAGCGTTTCTTCGTCAGCGCCCAGTACTGCGTCCACATGGACGGCTCTGTGATCGGTGGAGCCCCTATCGACACGTTTTTCGGGTTGTGCTGTACAATTT
CCTGTTGCTCTTCATGATCCTGAGAAATCCGCAAGAAAACTTCTTCTAAAGTCGTGACGGAGATGCCATACTGTTGCACTCCAAGTGCACTCATTTCAGC
ATCCAACTGCTCCAACATCGACGGGAAAACGTCTGAAGAAGCGGTCGGGAGTTGGAACACTAGCTCCGATCCAGAGCTGCTTAAACACTTGACTCCTGGC
ACGTATTTCTTTAGAAAATTCTCCACAAGCTGGGCGTCACAAGAGCCATCCGAAGTCTTGATCATAGTCAAATTATAACCCGCTCCAAAGCGATTTTTCA
GGAACAATGAAGACCCAGCACAACGCAGTTGACCGTCGGCTAGAATGGCGATACGATCGCCGAGAATGTCCGCTTCGTCCATGAAATGGGTTGTTAAAAC
AATGACGCGATCTTCGCGACTCTGCTGGAGTAAATTCCACGTAAATCGTCGAGAATAAGGGTCCATTCCAGACGTTGGTTCGTCCAAGAAGACGAGTTTA
CTGCCGCCAAGGAAGGCCAGAGCGACGCTGAGTTTGCGCTTCTGGCCTCCCGAGAGCGTCTTGGCCAGTGCATGGCGAATTTCCGTCAAACCTACGCTTT
CGATCATTTTTTCCACACTGGATTTCAGTTCGCCACGTGAAATCTGCTTCATGGTGGCAAAAAGCAACAAATGCTCTTCAACTGTAAGGTCTTGGAAAAG
CACGTCATGTTGTGGGCAAATGCCGATAACGCGTCGAAGCTCGTTGAAGTCGCGCTTGATGGAACAGCCGTACAGTGTTGCATCTCCCGCTGTGGGCGGG
ATGAGACCCGTGAGCATCGAGATGATCGTCGTCTTGCCAGCGCCATTATGACCCAACAGAGCAGTGATTTGGCCACTGTACATAGAGAGATCCAGCCCGG
CAACTGCGACGCGCTCCTCGCCGTCTTCTTCGAGAGGGAAAACTTTGCGCAACCCGCGGATCTGGAGACACGTGCCATTGCGCTCTTGTATCGCCAACGC
GGCGTTAACCGGCTCTACATACGCATTTCCACTCGGTTTGGCAATATTGTCAGTAAGTTGCGTATACACCCCGCCAGCTTGAGGTGACAGCGTGTAATTT
TCTGAGCTCGTAGCCATCTCGTCGTCTTTTGACTGATCGATCTTGTTAACCCAGTAACTTTTCGTCAACAAAAAGTACCAGGGCTTCCTCACGCCGTATT
GCTGAGGCAAAACCTGCTCCAAATACCATCCCAACGCCACGAGGATAACGGAGTCGAGCAGCAAGAACAGACTCATTCGAAATGCACTTGGAACTGTAAC
AGGTCCTTCGCGAAGGCCCACGGAATAGGCAAAGCCTGTGCCAAGTTGCGCTCGACGTAAGATCTCGTCAACGGCCAATGCAAATGCAGTAGGAGGCGAC
AGAGCGGCCCAGTACCGAGGCGTGTTTGTGTCTGCAGACTGCACTGCAAAGTATGGGAAGAAGAGAATGAGCCACAGAAGCACCGACGCGATGGCTGCGG
TCCTGGACTTGTTGAAGAATGGCGCGACAAAGTACGAAAAAGCTGTGATGGCCACACTGAGTGTCCAGAAGAGAAACACCAGTGTTGCGTACTCGGTCGT
AGGGAACACGTTGCCATATTTCAGTACGGCTGCAATGGCAAATGCCAATGGCGTGGCCAACACGGCTGTGGTTAAACACCACGAACACAGCAGAGTGGCG
TCGGATAGTCCCATGATCTTCATGACCTCGCGTAGTCTGTTTTCCTTCTCCATGACCATCGTCGTGGTCGTAGTTGACACAAATTTGATATAACTGACTA
GAAAAAATAGTCCCAGTACGGACTGCCCGCCAGTGTAGAACGATGTCATAGTGGACGACGGTCCGCCGATCGCTTCGAGTCCCCAGACGGCCAGGTCACT
GCAAATGAGCGTCTCGTTGGCATTTAGTTGCGCAGCTTCGGACGTGAACCACTGCGATCTCCAGCTATCTGCGAAATTGTCAAGGTTTGCCAGCAACAGC
AGCGCTGTGGAGAGCAAAACTGGCAGGAAAAGCTCCATGAGCAAGCTCACGGGGCGACGGCGACGCAGAACCATGTTTTTCCAGACCAGGTTGGTCACTT
GTGTCCATGTGGCTGCCACTTTTGCAGCGAAGTTGCTCTTTATCTGTTTGTAGAATCTGGCAAAAATCGCGATTGCCGCAACTGCAACTGCCACAATTGC
CACGACGGCGATGAGAATTGTGTTGGCGGACGAAATGCCTCCGTCACATTCATTCTGGTATGTGAAAACGTCATCGAACAGCTGCTTGCAAGTTGCCACT
GCTTCAGATGAAGTGTTGCAGGCTCGCAGCGACGCGGCAGCCGCGCAACATGAGGCCGAAGCTGACGATGTTTGCTCGGAACACATGACGCGGCAGACCG
AGTCTCCATTGAAATCGTCGCTATCATCGAAAGACCCGGAGGAGGAGAATGAGGACGAGTTTCGATCCTGGAAATCGTCCGGCAGCAGGTCGAAGAGCCC
CGAGTTGGTCACACACAGGCCGTACGCGATGTCGTTCTCCAGGACAGTCGTAACGCAGTTGGAGAGCGCCGTCAGCGTCGCGCTTTCGGCATCGTCCGAG
GACCCGGCGTCCGACATCGCAGAGTTTTTTTTATTGTGAGACGGTATTATCGAATTAGTGTCGGCTGGTGAATTGATTAACGGGGACTGGTTACGTAATC
TGCTCACTGGGGATTTGTACCTGTGAAAAAATGCATAACTGGGAGATTTGGTAGATGAATGGAGATTTTTAATGTGATGAAGACTGTAACAATTAGTGGA
TTGTGAAATAAAATACCTGGGCGGACAGCGCAAAATTGCCGCTTTGCAGGAAGTGGACACGGTTTACCTGACCTCCGTGTGACTGCAAGGCAACGGCGCT
TTGCCGTTCGTGAGCAGTTGTCATTTATGACAGGTCTCACAGTGGATACATGTAGTGCCCACTCTTGCCAGTGTGGAGGCGAGTTGCCACGCGATCGAAA
GACACAAAGTGGGCGGGTGCCAAGATGCAACGTTTTATTCTCTTCAACATGACTACTTTTAGGCCCT