Description :
From Genome Similarity Track
Location :
Scaffold_7:231604- 233216
Transcript NameFunction/comments
Albla_Nc14011480pyruvate kinase putative

Sequence
1612 bases(100 bases per row)
GCACTTACGCGACTTCGGCAACTCGCATAACGACTTGTCGCCCAAGATCATCGGATAGTGAGTCCGAACTTAAAAGCACCACACGGTCCTTTGAGACCAA
CCATCCCATCCGTTTCGCCTCTTTGATAGCTTCCGCTGCAGTAGGTCGGCTCGCTTGATTGGCTGGAACAACAGGGTACAATCCTCGATGAATTTGAAGT
TGTCGACCAATTTTACACGATGGTGTAAAGCACATAACTGGGACGGTGGGTCTGTATTTGGCAATCATCTGTGCCGTGCGTCCCGTATCAGTTAAGACAA
TCATCAACTTTGCTTTCATTTCATGTGCAGTCTTAACAACTGAACTTGCGACTGACTCGACATCATTTTCTGCTGGAGTCCACTCGTACTCGTGATAGTG
TGTCTCAAGTAACTCATCCGCTTCCTTGATAACGGTCATCATAGTTCGGACTGACTCGACAGGATACTTCCCATTTGCACATTCTCCACTCAGCATAACC
GCGTCAGCACCATCCAGGACAGCGTTACCCACATCGGACACCTCTGCGCGAGTAGGACGAGGATTCTGAATCATCGATTCGAGCATTTGAGTGGCAACGA
TAACCGGTTTACCAATTGCGTTGCATTTTTCAACCATTGACTTTTGATATGTTAACACTTTTTGTAGCGGTACTTCAACGCCTAAGTCACCACGGGCGAC
CATGATACCATTCGATACCTCCAAGATTTGATCGAAATTTTGAATACCTTCCAAATTTTCTATTTTTGATATAATCTTGGGAGCTGGGTGATCAGCCGGC
CAATGCTTTGACATTTGGGACTGAACGAATTCCCTAATCTCAATGACGTCACTTGGCTTGCGAATGAACGAAGCTGCAATAAAGTCCACGTCATGTTGGA
CACCGAACATCAAATCAACTTTATCTTTTTCCGATAGAGCCGGTAGGTCGACTTTTAATCCAGGCAGGTTGACACCTTTTGTATTACCGAGCTCTTCCGT
GTTCTTGATAACACATCGAATTTCGTTCTTCGCTTTGTCAACGTGTATCGCGTTGAGTCGGATCAAACCGTCCGATAAAAGAACTGTATCTCCCGATTTG
ACTGTGTTGACTAAATGCGGGTAGGTGATGTAAATTCGCTCCGCTGTTCCTTGATCTTGAAATTCCTTATTGTTGGTCAAAATTATTTCTTTGCCGGTTT
CCAAAAGCACCTTTTTCCCATTTTTCATTTTCCCAGTTCGAATTTCAGGTCCTTTTGTGTCCAATAGCACCGCTCGCAGGTTGAATGTGTTCTGGCTTTC
AGAGTGCACACCACGACAAGCTCGAAGGTTGTGGATGCCTACACAACTTGATTTTAGTATGCGGAAATATGAGACTGCACTTTGATACTACGTTGAAGCG
CCTCCGAGTGCTCTGCGTGAGAGAAATTTATTCGCATAATACGAAGCCCTTCATCGACCAGTTTTTGTGTCATATCTGGTGACTCGGATACTGGGCCGAT
TGTTCCAACAATCTAATGCGATACGACAGTTTATTGCACTGTGTAGAATGGGATGGAGTACCTTTGTCATTGAGAATTTTTCACTCCTGGGATTCTTGTA
ACCCCCACTTTG