Description :
From Genome Similarity Track
Location :
Scaffold_20:2316- 3888
Transcript NameFunction/comments
Phymu_g1326hypothetical protein PHYSODRAFT_332764

Sequence
1572 bases(100 bases per row)
GATACCGTTCTAGAACCTCAGGAAAATGCCGGATCAAAGAAGCCGTGAGTACTTCACATACACGGTCACTTAGCCGTTTACTGGGATCTTCAGCACAAAT
ACTTGTCTGGAAGAGAAGGTTGGCTATATCGCGGGCTTGTTCCCGTGTTGCAGAATCAAACCACGACAGCGTAGGCACCTGGGGCTTAGCGTTTGCGTCC
CATCCACTCAGAACTCTCGCAACCTTCTGATCTTCACTTGTGGTATTGAACACATACGCAAATGCCTTGTTCGTAGACGTCATGTTCCATGAACCACGGT
CGAAAATTCACTGGGCGCTTAGAGTAGCATCGCCGTTCGCATGCTGGCACCACCACGGCGGAAAGAATGCGAGGTCAAGTTTGGGGTAGGCTTTGCCTTT
GTTTGTGCTTCGCTCGCGGACTTGACAATGCGGTTGACGTATGCGTGTATCTTCATGTTATCATCGTTAggtttgcgcttcttcgtgaGGGGCTCGCTTG
AAGTCTCTGGGGCCGTTTCTGTGTTATCTCCGTCACAAGCTGCTAGTGCTTCTGCTAAAGGGATATCTATCGGAGTGACGGTTCTctcttcgtctccagt
aGCAAGTTGAGGATGGTCCAGTAGACGTGAGCTTGGTGTATCTTGCATTACCAGGGCCATGGCGATCGCATGTAGTGGGCAGGTGACGAAACTCACTTGA
TCAGGGAAGATCGATATACCTTGCTCTTCCGATGTCTTGACGCGTAGCAGTCTCACAAAGACGACTCCGTCAGCGCTTACGGTGAGGTTACTCTTCGTGA
CGAAGCCTAAGTCTGAAGCGCGGCCGAACGCATACCACATCAAGGCGAGGagcgcagcgtcttggtagtccttggagctggcagcgTAGAAATAAAGACC
GTCCATCAGAATACGTAGATCTTCCTTCGTGCACGCCGGCGCTCTCTTCGTAACACCACCTTCGATGCGCTTCAGGCAGTGCCGTTCAAGAGTCTGGGCC
ATCTTgagaagcttcttctcgattgAGGCTCTGTTCTTCGGGTAGGTGTCGAGTAACCAGTTTTTGACATGCCGGTAGTAGCTCATGACGGAGTTGCGTG
CCTTCTGCACTTGTAAGATGTATCGCGAAGCGATCCATCAGCTTGACAAACCTTGCTCCAGTCATATCACCTAGGAGCGTGGCTGCGATAAAATGCATAT
TGACGCCTTCAGACACGAGGAAGCGAGAGAACGCATTGATAGCTGTCTGCTGCGCACGCTGGGAGTTTACCGGCGCGAGGTCTTGCAAGCTCATACTGTT
TTGAAGTGGTTTTGTCGGTCAGAGGGGAAATATCCAAATGATGTAGAAACAGTTGATGGTTTGTATGAATTTTTACGCATATTTGGTACCCTTGCCGACA
TTATATGTCGGCACGCCGTCGGCAGCCTTTTCACCTAACCCTAATGACTCGGATTGGATAAAATAAATGTATGCACGGCTTGATTGGTTGTTTATCAAAT
ATCAACTCGATTCAACCATACTGAAACTAAGTAAGAAATAGTCTGTCGGCAGGTTAATGATATTCATCCATA