Description :
From Genome Similarity Track
Location :
contig_151:2316- 3515
Transcript NameFunction/comments
g11735.t1putative GPI anchor protein

Sequence
1199 bases(100 bases per row)
AGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTACGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGAT
GCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCA
CCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCAC
CAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACCACTGAAGACGTGTCTCTGACTGACCCCGTTGGCCCCATGAGC
GAGGAGGTGACCATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACG
ACGCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGA
CGGTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGT
TGTGAAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGA
AGATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCTGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGG
CTGCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCAC
TACTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCG
GCGAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCT