Description :
From Genome Similarity Track
Location :
contig_77:2315- 3667
Transcript NameFunction/comments
g12459.t1CCA24845.1 PREDICTED: copia proteinlike putative [Albugo laibachii Nc14

Sequence
1352 bases(100 bases per row)
AGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGCGACGCTGCGCATGATCATCGCGATCGCCAAGTACTT
CGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGATTCCCGAAGGCGTCGAACTGGAT
GGTGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCA
GCTTCCAAGTGTCGGCCTTCGATCCGTGCCTGTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGG
GAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTG
GTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTC
CGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGC
CACGCGCCCGGACATCGCGTACGCTGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTAC
CTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGGACGACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCCGACC
GCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCTACGAGCGAAGCGGA
GTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATG
ATCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACG
AAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCT
GACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGG